National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 8095R-1 
 Symbol scb  Full Name scab 
 CG No CG8095  Old CG No CG8095 
 Synonyms alphaPS3, E(sev-cycE)[e93], PS3, vol, alpha[[PS3]], alpha-PS3, Vol, CG8095, CT36929, CT21280, Dm0620, aPS3, E(Sev-CycE)E93, l(2)01288, alphaInt3, scb 
 Accession No (Link to NCBI) NM_079026.2 
 Inserted Chr. ll 
 Insertional Mutation  lethal 
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
Xie X, Auld VJ.
Integrins are necessary for the development and maintenance of the glial layers in the Drosophila peripheral nerve.
Development (2011) 138(17) 3813-22 [ PubMed ID = 21828098 ] [ RRC reference ]

Nonaka S, Nagaosa K, Mori T, Shiratsuchi A, Nakanishi Y.
Integrin αPS3/βν-mediated phagocytosis of apoptotic cells and bacteria in Drosophila.
J Biol Chem (2013) 288(15) 10374-80 [ PubMed ID = 23426364 ] [ RRC reference ]

Álvarez-Fernández C, Tamirisa S, Prada F, Chernomoretz A, Podhajcer O, Blanco E, Martín-Blanco E.
Identification and functional analysis of healing regulators in Drosophila.
PLoS Genet (2015) 11(2) e1004965 [ PubMed ID = 25647511 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgGAATCGACAATGTTCCCTCAC 
 Primer Seq. 3'
aatctagaggtaccGCCACCGTATTATTCACCCAG 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 NAATCGACAA TGTTCCCTCA CATATTCCTC GCCCTCTTGG CTCTGATCTC TCACATCGAA 
0061 GCATTCAATT TTATGCCGCG ACCCAGTCGG GTGATAAACT CCCCGAAGCA TCTGAAGTTC 
0121 CACATAAACC AGACTCGCAG CTCCTACTTT GGATACACGC TTGTCATCCG CCAGACCAGC 
0181 ATCATTGTGG GAGCCCCTAG AGCTCAATCC ACCTTGGAAT CGCAACGCAC CATCAACGAA 
0241 ACGGGAGCGA TCTACAGGTG CTCCCTGACA AACGGTGTGT GCAGTCCATA TGTCCTGGAT 
0301 TCCCGGGGCA ATGTGGATGC GCCCTATAGT GAGTACACAT TTGATTCGGA ACGCAAGGAC 
0361 TTTCAATGGC TGGGCGGATC GATGGACGGC GGCACCAAGG ACACGGACAA GCTCCTCGTG 
0421 TGTGCTCCTC GGTTCTACGC TCCCAGTTCC CGGGACAACC ACCTGCATGG AGTCTGCTAC 
0481 TGGGTGAATA ATACGGTGGC  
 in silico PCR Fragment
0001 GAATCGACAA TGTTCCCTCA CATATTCCTC GCCCTCTTGG CTCTGATCTC TCACATCGAA 
0061 GCATTCAATT TTATGCCGCG ACCCAGTCGG GTGATAAACT CCCCGAAGCA TCTGAAGTTC 
0121 CACATAAACC AGACTCGCAG CTCCTACTTT GGATACACGC TTGTCATCCG CCAGACCAGC 
0181 ATCATTGTGG GAGCCCCTAG AGCTCAATCC ACCTTGGAAT CGCAACGCAC CATCAACGAA 
0241 ACGGGAGCGA TCTACAGATG CTCCCTGACA AACGGTGTGT GCAGTCCATA TGTCCTGGAT 
0301 TCCCGGGGCA ATGTGGATGC GCCCTATAGT GAGTACACAT TTGATTCGGA ACGCAAGGAC 
0361 TTTCAATGGC TGGGCGGATC GATGGACGGC GGCACCAAGG ACACGGACAA GCTCCTCGTG 
0421 TGTGCTCCTC GGTTCTACGC TCCCAGTTCC CGGGACAACC ACCTGCATGG AGTCTGCTAC 
0481 TGGGTGAATA ATACGGTGGC  
 Assemble Data

8095R-1.IR_full        1   AATCGACAATGTTCCCTCACATATTCCTCGCCCTCTTGGCTCTGATCTCTCACATCGAA 59
                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8095R-1.in silico      1   AATCGACAATGTTCCCTCACATATTCCTCGCCCTCTTGGCTCTGATCTCTCACATCGAA 59


8095R-1.IR_full       61  GCATTCAATTTTATGCCGCGACCCAGTCGGGTGATAAACTCCCCGAAGCATCTGAAGTTC 119
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8095R-1.in silico     61  GCATTCAATTTTATGCCGCGACCCAGTCGGGTGATAAACTCCCCGAAGCATCTGAAGTTC 119


8095R-1.IR_full       121 CACATAAACCAGACTCGCAGCTCCTACTTTGGATACACGCTTGTCATCCGCCAGACCAGC 179
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8095R-1.in silico     121 CACATAAACCAGACTCGCAGCTCCTACTTTGGATACACGCTTGTCATCCGCCAGACCAGC 179


8095R-1.IR_full       181 ATCATTGTGGGAGCCCCTAGAGCTCAATCCACCTTGGAATCGCAACGCACCATCAACGAA 239
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8095R-1.in silico     181 ATCATTGTGGGAGCCCCTAGAGCTCAATCCACCTTGGAATCGCAACGCACCATCAACGAA 239


8095R-1.IR_full       241 ACGGGAGCGATCTACAGGTGCTCCCTGACAAACGGTGTGTGCAGTCCATATGTCCTGGAT 299
                          ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||
8095R-1.in silico     241 ACGGGAGCGATCTACAGATGCTCCCTGACAAACGGTGTGTGCAGTCCATATGTCCTGGAT 299


8095R-1.IR_full       301 TCCCGGGGCAATGTGGATGCGCCCTATAGTGAGTACACATTTGATTCGGAACGCAAGGAC 359
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8095R-1.in silico     301 TCCCGGGGCAATGTGGATGCGCCCTATAGTGAGTACACATTTGATTCGGAACGCAAGGAC 359


8095R-1.IR_full       361 TTTCAATGGCTGGGCGGATCGATGGACGGCGGCACCAAGGACACGGACAAGCTCCTCGTG 419
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8095R-1.in silico     361 TTTCAATGGCTGGGCGGATCGATGGACGGCGGCACCAAGGACACGGACAAGCTCCTCGTG 419


8095R-1.IR_full       421 TGTGCTCCTCGGTTCTACGCTCCCAGTTCCCGGGACAACCACCTGCATGGAGTCTGCTAC 479
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8095R-1.in silico     421 TGTGCTCCTCGGTTCTACGCTCCCAGTTCCCGGGACAACCACCTGCATGGAGTCTGCTAC 479


8095R-1.IR_full       481 TGGGTGAATAATACGGTGGC 499
                          ||||||||||||||||||||
8095R-1.in silico     481 TGGGTGAATAATACGGTGGC 499

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_079026.2  CG8095-RB, transcript variant B (scb), mRNA 
63.07   304  NM_166083.1  CG8095-RA, transcript variant A (scb), mRNA 
0   30  40  51  NM_137964.1  CG5372-RA (alphaPS5), mRNA 
0   NM_079919.2  CG5700-RB (prc), mRNA 
0   NM_057657.4  CG17158-RA (cpb), mRNA 
0   NM_169609.1  CG31304-RA (CG31304), mRNA 
0   NM_141673.4  CG31352-RA (CG31352), mRNA 
0   12  NM_136864.2  CG13185-RA (CG13185), mRNA 
0   NM_167088.1  CG3203-RB, transcript variant B (RpL17), mRNA 
0   NM_167089.1  CG3203-RC, transcript variant C (RpL17), mRNA 
0   NM_132118.2  CG3203-RD, transcript variant D (RpL17), mRNA 
0   NM_167087.1  CG3203-RA, transcript variant A (RpL17), mRNA 
0   11  NM_001043277.1  CG31163-RD, transcript variant D (CG31163), mRNA 
0   11  NM_169997.3  CG31163-RB, transcript variant B (CG31163), mRNA 
0   NM_167193.1  CG32702-RA (CG32702), mRNA 
0   NM_142055.1  CG9322-RA (CG9322), mRNA 
0   NM_206274.2  CG12605-RC, transcript variant C (CG12605), mRNA 
0   NM_206275.2  CG12605-RA, transcript variant A (CG12605), mRNA 
0   NM_139588.3  CG12605-RB, transcript variant B (CG12605), mRNA 
0   NM_078571.2  CG1705-RA (Rst(1)JH), mRNA 
0   NM_134614.1  CG14621-RA (CG14621), mRNA 
0   NM_169374.1  CG31299-RA, transcript variant A (nocturnin), mRNA 
0   NM_165305.2  CG10188-RA, transcript variant A (CG10188), mRNA 
0   NM_136133.2  CG10188-RB, transcript variant B (CG10188), mRNA 
0   NM_169375.1  CG31299-RB, transcript variant B (nocturnin), mRNA 
0   NM_167023.1  CG32770-RA (CG32770), mRNA 
0   NM_176247.1  CG33143-RB, transcript variant B (CG33143), mRNA 
0   NM_176246.1  CG33143-RC, transcript variant C (CG33143), mRNA 
0   NM_080333.2  CG3346-RA (pon), mRNA 
0   NM_138093.2  CG4681-RA (CG4681), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.