National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 8091R-1 
 Symbol Nc  Full Name Nedd2-like caspase 
 CG No CG8091  Old CG No CG8091 
 Synonyms dronc, DRONC, Dronc, CG8091, caspase-9, anon-EST:GreesD6, anon-EST:GressD6, anon-WO0118547.313, Nc, Dronc/Casp9 
 Accession No (Link to NCBI) NM_079293.2 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
[Please submit your publication]
Jo J, Im SH, Babcock DT, Iyer SC, Gunawan F, Cox DN, Galko MJ.
Drosophila caspase activity is required independently of apoptosis to produce active TNF/Eiger during nociceptive sensitization.
Cell Death Dis (2017) 8(5) e2786 [ PubMed ID = 28492538 ] [ RRC reference ]

Tsai CR, Anderson AE, Burra S, Jo J, Galko MJ.
Yorkie regulates epidermal wound healing in Drosophila larvae independently of cell proliferation and apoptosis.
Dev. Biol. (2017) 427(1) 61-71 [ PubMed ID = 28514643 ] [ RRC reference ]

Suissa Y, Ziv O, Dinur T, Arama E, Gerlitz O.
The NAB-Brk signal bifurcates at JNK to independently induce apoptosis and compensatory proliferation.
J. Biol. Chem. (2011) 286(17) 15556-64 [ PubMed ID = 21385866 ] [ RRC reference ]

Babcock DT, Landry C, Galko MJ.
Cytokine signaling mediates UV-induced nociceptive sensitization in Drosophila larvae.
Curr. Biol. (2009) 19(10) 799-806 [ PubMed ID = 19375319 ] [ RRC reference ]

Zhang S, Chen C, Wu C, Yang Y, Li W, Xue L.
The canonical Wg signaling modulates Bsk-mediated cell death in Drosophila.
Cell Death Dis (2015) 6 e1713 [ PubMed ID = 25855961 ] [ RRC reference ]

Oshima K, Takeda M, Kuranaga E, Ueda R, Aigaki T, Miura M, Hayashi S.
IKK epsilon regulates F actin assembly and interacts with Drosophila IAP1 in cellular morphogenesis.
Curr. Biol. (2006) 16(15) 1531-7 [ PubMed ID = 16887350 ] [ RRC reference ]

Cho Y, Lai CM, Lin KY, Hsu HJ.
A Targeted RNAi Screen Reveals Drosophila Female-Sterile Genes That Control the Size of Germline Stem Cell Niche During Development.
G3 (Bethesda) (2018) 8(7) 2345-2354 [ PubMed ID = 29764959 ] [ RRC reference ]

Leulier F, Ribeiro PS, Palmer E, Tenev T, Takahashi K, Robertson D, Zachariou A, Pichaud F, Ueda R, Meier P.
Systematic in vivo RNAi analysis of putative components of the Drosophila cell death machinery.
Cell Death Differ. (2006) 13(10) 1663-74 [ PubMed ID = 16485033 ] [ RRC reference ]  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     1   GCAAGCCATTCAACATGGACGAGAAGGATGTGCGTGTGGAGCAGCATCGTAGGCTCCTAT 60

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     61  TGAAGATCACCCAGCGTGGTCCCACCGCCTATAACCTGCTGATCAATGCACTGCGCAATA 120

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     121 TCAATTGTCTGGATGCGGCCGTTCTATTGGAATCCGTCGATGAGTCCGATTCAAGGCCAC 180

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     181 CCTTTATCTCGCTAAACGAACGGAGAACCAGCCGGAAGTCGGCCGATATTGTGGACACAC 240

                          ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| silico     241 CCTCACCCGAAGCCTCCGAAGGACCCTGCGTTAGCAAGCTCCGGAATGAGCCGCTGGGAG 300

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     301 CACTCACCCCTTATGTGGGTGTCGTTGACGGTCCCGAGGTAAAAAAATCGAAAAAGATAC 360

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     361 ATGGTGGGGATAGTGCCATATTGGGCACATATAAGATGCAATCACGTTTCAACCGAGGCG 420

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     421 TTTTGCTAATGGTTAACATAATGGACTATCCGGATCAAAACCGTCGACGGATCGGAGCCG 480

8091R-1.IR_full       481 AAAAGGACAGCAAGTCGTTG 500
                          |||||||||||||||||||| silico     481 AAAAGGACAGCAAGTCGTTG 500

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_079293.2  CG8091-RA (Nc), mRNA 
0   NM_057512.3  CG3724-RA (Pgd), mRNA 
0   12  NM_167080.1  CG32742-RA (l(1)G0148), mRNA 
0   NM_079319.2  CG4153-RA (eIF-2beta), mRNA 
0   NM_143432.2  CG31445-RA (CG31445), mRNA 
0   NM_165802.1  CG30015-RA, transcript variant A (CG30015), mRNA 
0   NM_136777.2  CG30015-RB, transcript variant B (CG30015), mRNA 
0   NM_167233.1  CG32687-RA (CG32687), mRNA 
0   NM_140070.2  CG3424-RA, transcript variant A (path), mRNA 
0   NM_168722.1  CG6512-RB, transcript variant B (CG6512), mRNA 
0   NM_168720.1  CG6512-RA, transcript variant A (CG6512), mRNA 
0   NM_136154.1  CG10631-RA (CG10631), mRNA 
0   NM_057605.3  CG17907-RA (Ace), mRNA 
0   NM_078875.2  CG10446-RA (Side), mRNA 
0   NM_078604.3  CG32592-RA (hiw), mRNA 
0   NM_132185.1  CG15325-RA (CG15325), mRNA 
0   NM_165170.2  CG31807-RA (CG31807), mRNA 
0   NM_136497.3  CG8726-RB, transcript variant B (CG8726), mRNA 
0   NM_165580.2  CG8726-RA, transcript variant A (CG8726), mRNA 
0   NM_144312.1  CG16978-RA (CG16978), mRNA 
0   NM_167386.1  CG32626-RD, transcript variant D (CG32626), mRNA 
0   NM_132703.2  CG32626-RC, transcript variant C (CG32626), mRNA 
0   NM_167384.1  CG32626-RA, transcript variant A (CG32626), mRNA 
0   NM_167385.1  CG32626-RB, transcript variant B (CG32626), mRNA 
0   NM_142828.1  CG13842-RA (CG13842), mRNA 
0   NM_205875.1  CG32019-RE, transcript variant E (bt), mRNA 
0   NM_166790.2  CG32019-RA, transcript variant A (bt), mRNA 
0   NM_205877.1  CG32019-RD, transcript variant D (bt), mRNA 
0   NM_205876.1  CG32019-RC, transcript variant C (bt), mRNA 
0   NM_166096.1  CG30470-RA (CG30470), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.