National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 8056R-3 
 Symbol Krn  Full Name Keren 
 CG No CG32179  Old CG No CG8056 
 Synonyms keren/spitz2, keren, Ker, CT19073, gritz, CG8056, CG32179, Krn, s-krn 
 Accession No (Link to NCBI) NM_079405.3 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
[Please submit your publication]
Zhang P, Holowatyj AN, Roy T, Pronovost SM, Marchetti M, Liu H, Ulrich CM, Edgar BA.
An SH3PX1-Dependent Endocytosis-Autophagy Network Restrains Intestinal Stem Cell Proliferation by Counteracting EGFR-ERK Signaling.
Dev Cell (2019) 49(4) 574-589.e5 [ PubMed ID = 31006650 ] [ RRC reference ]

Duncan OF, Granat L, Ranganathan R, Singh VK, Mazaud D, Fanto M, Chambers D, Ballard CG, Bateman JM.
Ras-ERK-ETS inhibition alleviates neuronal mitochondrial dysfunction by reprogramming mitochondrial retrograde signaling.
PLoS Genet (2018) 14(7) e1007567 [ PubMed ID = 30059502 ] [ RRC reference ]

Xu N, Wang SQ, Tan D, Gao Y, Lin G, Xi R.
EGFR, Wingless and JAK/STAT signaling cooperatively maintain Drosophila intestinal stem cells.
Dev Biol (2011) 354(1) 31-43 [ PubMed ID = 21440535 ] [ RRC reference ]

Umetsu D, Dunst S, Dahmann C.
An RNA interference screen for genes required to shape the anteroposterior compartment boundary in Drosophila identifies the Eph receptor.
PLoS One (2014) 9(12) e114340 [ PubMed ID = 25473846 ] [ RRC reference ]  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     1   GGATCTGCTGCTGCTTGCCACCGCTTTAATCGGCGCTTACCTACCGCTCACCGCCGCCTG 60

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     61  TTCCTCGCGTGCCATCGCTAAGCCGCGGCCAACAGCTGCACCGATCCTGCCGCCGGATAA 120

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     121 TGTGGAAATATCCACAACGCCGAGACCGAATGTCACCTTCCCGATCTTCGCCTGTCCACC 180

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     181 GACCTATGTCGCCTGGTATTGCCTGAACGATGGCACCTGCTTTACGGTGAAGATCCACAA 240

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     241 TGAAATCCTATACAACTGCGAATGTGCGCTGGGATTTATGGGTCCGAGGTGCGAGTACAA 300

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     301 GGAGATTGATGGCTCGTACCTGCCAACCAGGAACCGTGTGATGCTAGAGAAGGCCAGCAT 360

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     361 TGTTAGCGGAGCAACGCTGGCCCTTCTGTTTATGGCCATGTGCTGTGTGGTTTTGTATCT 420

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     421 GCGACACGAGAAGCTGCAAAAACAAAAGCTGCACGACAGCACCACAACCACAACGACCGA 480

8056R-3.IR_full       481 CGGTGGCTGTCAGAACGAGG 500
                          |||||||||||||||||||| silico     481 CGGTGGCTGTCAGAACGAGG 500

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_079405.3  CG32179-RA (Krn), mRNA 
0   13  NM_132912.1  CG4521-RA (mthl1), mRNA 
0   16  NM_169453.1  CG10095-RA (dpr15), mRNA 
0   NM_132932.2  CG9634-RA (CG9634), mRNA 
0   NM_136347.1  CG14471-RB, transcript variant B (CG14471), mRNA 
0   NM_206324.1  CG33267-RA (CG33267), mRNA 
0   19  NM_205928.1  CG8086-RD, transcript variant D (CG8086), mRNA 
0   19  NM_205929.1  CG8086-RC, transcript variant C (CG8086), mRNA 
0   NM_142903.2  CG10183-RA (CG10183), mRNA 
0   NM_137672.1  CG15225-RA (CG15225), mRNA 
0   NM_135892.2  CG4185-RA (NC2beta), mRNA 
0   NM_001014642.1  CG33518-RA (mun), mRNA 
0   10  NM_132086.1  CG15894-RA (CG15894), mRNA 
0   NM_137238.2  CG8403-RA (SP2353), mRNA 
0   NM_001042904.1  CG15148-RB, transcript variant B (btv), mRNA 
0   NM_001042905.1  CG15148-RC, transcript variant C (btv), mRNA 
0   NM_136013.1  CG15148-RA, transcript variant A (btv), mRNA 
0   NM_140476.2  CG5392-RA (CG5392), mRNA 
0   NM_132793.2  CG9164-RA, transcript variant A (CG9164), mRNA 
0   NM_167440.1  CG9164-RC, transcript variant C (CG9164), mRNA 
0   NM_080529.2  CG9854-RA, transcript variant A (hrg), mRNA 
0   NM_166372.1  CG9854-RB, transcript variant B (hrg), mRNA 
0   NM_001043097.1  CG9854-RC, transcript variant C (hrg), mRNA 
0   NM_136177.2  CG10730-RA (CG10730), mRNA 
0   NM_133004.1  CG8211-RA (CG8211), mRNA 
0   NM_132428.1  CG17333-RA (CG17333), mRNA 
0   NM_140735.1  CG6311-RB (CG6311), mRNA 
0   45  70  NM_001032052.1  CG33715-RE, transcript variant E (Msp-300), mRNA 
0   20  119  NM_170227.2  CG31439-RA (CG31439), mRNA 
0   NM_001043241.1  CG14713-RB (CG14713), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.