National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
Notification of resumption of orders:

Orders have been suspended as a response to the COVID-19 infection, but it will be resumed today, May 11. However, we would like to set our organizational framework that prioritizes the maintenance of stocks for the time being. In addition, due to delays in delivery of postal items, it is expected that the flies you ordered will not reach you in normal period. We apologize for the inconvenience.

Thank you for your understanding.

NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 8056R-3 
 Symbol Krn  Full Name Keren 
 CG No CG32179  Old CG No CG8056 
 Synonyms keren/spitz2, keren, Ker, CT19073, gritz, CG8056, CG32179, Krn, s-krn 
 Accession No (Link to NCBI) NM_079405.3 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
Zhang P, Holowatyj AN, Roy T, Pronovost SM, Marchetti M, Liu H, Ulrich CM, Edgar BA.
An SH3PX1-Dependent Endocytosis-Autophagy Network Restrains Intestinal Stem Cell Proliferation by Counteracting EGFR-ERK Signaling.
Dev. Cell (2019) [ PubMed ID = 31006650 ] [ RRC reference ]

Xu N, Wang SQ, Tan D, Gao Y, Lin G, Xi R.
EGFR, Wingless and JAK/STAT signaling cooperatively maintain Drosophila intestinal stem cells.
Dev. Biol. (2011) 354(1) 31-43 [ PubMed ID = 21440535 ] [ RRC reference ]

Duncan OF, Granat L, Ranganathan R, Singh VK, Mazaud D, Fanto M, Chambers D, Ballard CG, Bateman JM.
Ras-ERK-ETS inhibition alleviates neuronal mitochondrial dysfunction by reprogramming mitochondrial retrograde signaling.
PLoS Genet. (2018) 14(7) e1007567 [ PubMed ID = 30059502 ] [ RRC reference ]

Umetsu D, Dunst S, Dahmann C.
An RNA interference screen for genes required to shape the anteroposterior compartment boundary in Drosophila identifies the Eph receptor.
PLoS ONE (2014) 9(12) e114340 [ PubMed ID = 25473846 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgGGATCTGCTGCTGCTTGCCAC 
 Primer Seq. 3'
aatctagaggtaccCCTCGTTCTGACAGCCACCGT 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 GGATCTGCTG CTGCTTGCCA CCGCTTTAAT CGGCGCTTAC CTACCGCTCA CCGCCGCCTG 
0061 TTCCTCGCGT GCCATCGCTA AGCCGCGGCC AACAGCTGCA CCGATCCTGC CGCCGGATAA 
0121 TGTGGAAATA TCCACAACGC CGAGACCGAA TGTCACCTTC CCGATCTTCG CCTGTCCACC 
0181 GACCTATGTC GCCTGGTATT GCCTGAACGA TGGCACCTGC TTTACGGTGA AGATCCACAA 
0241 TGAAATCCTA TACAACTGCG AATGTGCGCT GGGATTTATG GGTCCGAGGT GCGAGTACAA 
0301 GGAGATTGAT GGCTCGTACC TGCCAACCAG GAACCGTGTG ATGCTAGAGA AGGCCAGCAT 
0361 TGTTAGCGGA GCAACGCTGG CCCTTCTGTT TATGGCCATG TGCTGTGTGG TTTTGTATCT 
0421 GCGACACGAG AAGCTGCAAA AACAAAAGCT GCACGACAGC ACCACAACCA CAACGACCGA 
0481 CGGTGGCTGT CAGAACGAGG  
 in silico PCR Fragment
0001 GGATCTGCTG CTGCTTGCCA CCGCTTTAAT CGGCGCTTAC CTACCGCTCA CCGCCGCCTG 
0061 TTCCTCGCGT GCCATCGCTA AGCCGCGGCC AACAGCTGCA CCGATCCTGC CGCCGGATAA 
0121 TGTGGAAATA TCCACAACGC CGAGACCGAA TGTCACCTTC CCGATCTTCG CCTGTCCACC 
0181 GACCTATGTC GCCTGGTATT GCCTGAACGA TGGCACCTGC TTTACGGTGA AGATCCACAA 
0241 TGAAATCCTA TACAACTGCG AATGTGCGCT GGGATTTATG GGTCCGAGGT GCGAGTACAA 
0301 GGAGATTGAT GGCTCGTACC TGCCAACCAG GAACCGTGTG ATGCTAGAGA AGGCCAGCAT 
0361 TGTTAGCGGA GCAACGCTGG CCCTTCTGTT TATGGCCATG TGCTGTGTGG TTTTGTATCT 
0421 GCGACACGAG AAGCTGCAAA AACAAAAGCT GCACGACAGC ACCACAACCA CAACGACCGA 
0481 CGGTGGCTGT CAGAACGAGG  
 Assemble Data

8056R-3.IR_full       1   GGATCTGCTGCTGCTTGCCACCGCTTTAATCGGCGCTTACCTACCGCTCACCGCCGCCTG 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8056R-3.in silico     1   GGATCTGCTGCTGCTTGCCACCGCTTTAATCGGCGCTTACCTACCGCTCACCGCCGCCTG 60


8056R-3.IR_full       61  TTCCTCGCGTGCCATCGCTAAGCCGCGGCCAACAGCTGCACCGATCCTGCCGCCGGATAA 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8056R-3.in silico     61  TTCCTCGCGTGCCATCGCTAAGCCGCGGCCAACAGCTGCACCGATCCTGCCGCCGGATAA 120


8056R-3.IR_full       121 TGTGGAAATATCCACAACGCCGAGACCGAATGTCACCTTCCCGATCTTCGCCTGTCCACC 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8056R-3.in silico     121 TGTGGAAATATCCACAACGCCGAGACCGAATGTCACCTTCCCGATCTTCGCCTGTCCACC 180


8056R-3.IR_full       181 GACCTATGTCGCCTGGTATTGCCTGAACGATGGCACCTGCTTTACGGTGAAGATCCACAA 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8056R-3.in silico     181 GACCTATGTCGCCTGGTATTGCCTGAACGATGGCACCTGCTTTACGGTGAAGATCCACAA 240


8056R-3.IR_full       241 TGAAATCCTATACAACTGCGAATGTGCGCTGGGATTTATGGGTCCGAGGTGCGAGTACAA 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8056R-3.in silico     241 TGAAATCCTATACAACTGCGAATGTGCGCTGGGATTTATGGGTCCGAGGTGCGAGTACAA 300


8056R-3.IR_full       301 GGAGATTGATGGCTCGTACCTGCCAACCAGGAACCGTGTGATGCTAGAGAAGGCCAGCAT 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8056R-3.in silico     301 GGAGATTGATGGCTCGTACCTGCCAACCAGGAACCGTGTGATGCTAGAGAAGGCCAGCAT 360


8056R-3.IR_full       361 TGTTAGCGGAGCAACGCTGGCCCTTCTGTTTATGGCCATGTGCTGTGTGGTTTTGTATCT 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8056R-3.in silico     361 TGTTAGCGGAGCAACGCTGGCCCTTCTGTTTATGGCCATGTGCTGTGTGGTTTTGTATCT 420


8056R-3.IR_full       421 GCGACACGAGAAGCTGCAAAAACAAAAGCTGCACGACAGCACCACAACCACAACGACCGA 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8056R-3.in silico     421 GCGACACGAGAAGCTGCAAAAACAAAAGCTGCACGACAGCACCACAACCACAACGACCGA 480


8056R-3.IR_full       481 CGGTGGCTGTCAGAACGAGG 500
                          ||||||||||||||||||||
8056R-3.in silico     481 CGGTGGCTGTCAGAACGAGG 500

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_079405.3  CG32179-RA (Krn), mRNA 
0   13  NM_132912.1  CG4521-RA (mthl1), mRNA 
0   16  NM_169453.1  CG10095-RA (dpr15), mRNA 
0   NM_132932.2  CG9634-RA (CG9634), mRNA 
0   NM_136347.1  CG14471-RB, transcript variant B (CG14471), mRNA 
0   NM_206324.1  CG33267-RA (CG33267), mRNA 
0   19  NM_205928.1  CG8086-RD, transcript variant D (CG8086), mRNA 
0   19  NM_205929.1  CG8086-RC, transcript variant C (CG8086), mRNA 
0   NM_142903.2  CG10183-RA (CG10183), mRNA 
0   NM_137672.1  CG15225-RA (CG15225), mRNA 
0   NM_135892.2  CG4185-RA (NC2beta), mRNA 
0   NM_001014642.1  CG33518-RA (mun), mRNA 
0   10  NM_132086.1  CG15894-RA (CG15894), mRNA 
0   NM_137238.2  CG8403-RA (SP2353), mRNA 
0   NM_001042904.1  CG15148-RB, transcript variant B (btv), mRNA 
0   NM_001042905.1  CG15148-RC, transcript variant C (btv), mRNA 
0   NM_136013.1  CG15148-RA, transcript variant A (btv), mRNA 
0   NM_140476.2  CG5392-RA (CG5392), mRNA 
0   NM_132793.2  CG9164-RA, transcript variant A (CG9164), mRNA 
0   NM_167440.1  CG9164-RC, transcript variant C (CG9164), mRNA 
0   NM_080529.2  CG9854-RA, transcript variant A (hrg), mRNA 
0   NM_166372.1  CG9854-RB, transcript variant B (hrg), mRNA 
0   NM_001043097.1  CG9854-RC, transcript variant C (hrg), mRNA 
0   NM_136177.2  CG10730-RA (CG10730), mRNA 
0   NM_133004.1  CG8211-RA (CG8211), mRNA 
0   NM_132428.1  CG17333-RA (CG17333), mRNA 
0   NM_140735.1  CG6311-RB (CG6311), mRNA 
0   45  70  NM_001032052.1  CG33715-RE, transcript variant E (Msp-300), mRNA 
0   20  119  NM_170227.2  CG31439-RA (CG31439), mRNA 
0   NM_001043241.1  CG14713-RB (CG14713), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.