National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 7996R-2 
 Symbol snk  Full Name snake 
 CG No CG7996  Old CG No CG7996 
 Synonyms SP26, c-SP26, CG7996, me(3)4, l(3)87Dg, snk, snake, SNK 
 Accession No (Link to NCBI) NM_079614.2 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
Nakaoka T, Iga M, Yamada T, Koujima I, Takeshima M, Zhou X, Suzuki Y, Ogihara MH, Kataoka H.
Deep sequencing of the prothoracic gland transcriptome reveals new players in insect ecdysteroidogenesis.
PLoS One (2017) 12(3) e0172951 [ PubMed ID = 28257485 ] [ RRC reference ]

Cho Y, Lai CM, Lin KY, Hsu HJ.
A Targeted RNAi Screen Reveals Drosophila Female-Sterile Genes That Control the Size of Germline Stem Cell Niche During Development.
G3 (Bethesda) (2018) 8(7) 2345-2354 [ PubMed ID = 29764959 ] [ RRC reference ]

Kambris Z, Brun S, Jang IH, Nam HJ, Romeo Y, Takahashi K, Lee WJ, Ueda R, Lemaitre B.
Drosophila immunity: a large-scale in vivo RNAi screen identifies five serine proteases required for Toll activation.
Curr Biol (2006) 16(8) 808-13 [ PubMed ID = 16631589 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgTTGAGGCTCTCGATGCCCTTG 
 Primer Seq. 3'
aatctagaggtaccGGGGGTTCCACCGACTATCAG 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 TTGAGGCTCT CGATGCCCTT GAAATAATCA ACTACCAGAC CACCAAGTAC ACAATCCCCG 
0061 AAGTTTGGAA AGAGCAGCCA GTGGCGACCA TTGGBGAGGA CGTGGATGAT CAGGACACCG 
0121 AAGATGAGGA AAGCTATCTG AAGTTCGGCG ACGATGCGGA GGTTAGGACT TCGGTTTCGG 
0181 AAGGACTTCA CGAAGGTGCC TTCTGCCGGC GGAGCTTCGA TGGCCGGAGT GGATACTGCA 
0241 TCCTGGCCTA TCAGTGCCTC CACGTCATCC GAGAGTATCG GGTGCATGGC ACCCGCATCG 
0301 ACATCTGCAC CCATCGCAAC AATGTCCCTG TCATCTGTTG TCCATTGGCG GACAAGCATG 
0361 TGCTGGNTCA GCGCATAAGT GCCACCAAAT GTCAGGAGTA CANTNNTGNC gNCAGAAGGC 
0421 TTCACTTGAC GGACACCGGA CGCACATTCT CCGGGAAGCA GTGTGTGCCC AGTGTTCCCC 
0481 TGATAGTCGG TGGAACCCCC  
 in silico PCR Fragment
0001 TTGAGGCTCT CGATGCCCTT GAAATAATCA ACTACCAGAC CACCAAGTAC ACAATCCCCG 
0061 AAGTTTGGAA AGAGCAGCCA GTGGCGACCA TTGGCGAGGA CGTGGATGAT CAGGACACCG 
0121 AAGATGAGGA AAGCTATCTG AAGTTCGGCG ACGATGCGGA GGTTAGGACT TCGGTTTCGG 
0181 AAGGACTTCA CGAAGGTGCC TTCTGCCGGC GGAGCTTCGA TGGCCGGAGT GGATACTGCA 
0241 TCCTGGCCTA TCAGTGCCTC CACGTCATTC GAGAGTATCG GGTGCATGGC ACCCGCATCG 
0301 ACATCTGCAC CCATCGCAAC AATGTCCCTG TCATCTGTTG TCCATTGGCG GACAAGCATG 
0361 TGCTGGCTCA GCGCATAAGT GCCACCAAAT GTCAGGAGTA CAATGCTGCC GCCAGAAGGC 
0421 TTCACTTGAC GGACACCGGA CGCACATTCT CCGGGAAGCA GTGTGTGCCC AGTGTTCCCC 
0481 TGATAGTCGG TGGAACCCCC  
 Assemble Data

7996R-2.IR_full       1   TTGAGGCTCTCGATGCCCTTGAAATAATCAACTACCAGACCACCAAGTACACAATCCCCG 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7996R-2.in silico     1   TTGAGGCTCTCGATGCCCTTGAAATAATCAACTACCAGACCACCAAGTACACAATCCCCG 60


7996R-2.IR_full       61  AAGTTTGGAAAGAGCAGCCAGTGGCGACCATTGGBGAGGACGTGGATGATCAGGACACCG 120
                          |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||
7996R-2.in silico     61  AAGTTTGGAAAGAGCAGCCAGTGGCGACCATTGGCGAGGACGTGGATGATCAGGACACCG 120


7996R-2.IR_full       121 AAGATGAGGAAAGCTATCTGAAGTTCGGCGACGATGCGGAGGTTAGGACTTCGGTTTCGG 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7996R-2.in silico     121 AAGATGAGGAAAGCTATCTGAAGTTCGGCGACGATGCGGAGGTTAGGACTTCGGTTTCGG 180


7996R-2.IR_full       181 AAGGACTTCACGAAGGTGCCTTCTGCCGGCGGAGCTTCGATGGCCGGAGTGGATACTGCA 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7996R-2.in silico     181 AAGGACTTCACGAAGGTGCCTTCTGCCGGCGGAGCTTCGATGGCCGGAGTGGATACTGCA 240


7996R-2.IR_full       241 TCCTGGCCTATCAGTGCCTCCACGTCATCCGAGAGTATCGGGTGCATGGCACCCGCATCG 300
                          |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||
7996R-2.in silico     241 TCCTGGCCTATCAGTGCCTCCACGTCATTCGAGAGTATCGGGTGCATGGCACCCGCATCG 300


7996R-2.IR_full       301 ACATCTGCACCCATCGCAACAATGTCCCTGTCATCTGTTGTCCATTGGCGGACAAGCATG 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7996R-2.in silico     301 ACATCTGCACCCATCGCAACAATGTCCCTGTCATCTGTTGTCCATTGGCGGACAAGCATG 360


7996R-2.IR_full       361 TGCTGGNTCAGCGCATAAGTGCCACCAAATGTCAGGAGTACANTNNTGNCGNCAGAAGGC 420
                          |||||| ||||||||||||||||||||||||||||||||||| |  || || ||||||||
7996R-2.in silico     361 TGCTGGCTCAGCGCATAAGTGCCACCAAATGTCAGGAGTACAATGCTGCCGCCAGAAGGC 420


7996R-2.IR_full       421 TTCACTTGACGGACACCGGACGCACATTCTCCGGGAAGCAGTGTGTGCCCAGTGTTCCCC 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7996R-2.in silico     421 TTCACTTGACGGACACCGGACGCACATTCTCCGGGAAGCAGTGTGTGCCCAGTGTTCCCC 480


7996R-2.IR_full       481 TGATAGTCGGTGGAACCCCC 500
                          ||||||||||||||||||||
7996R-2.in silico     481 TGATAGTCGGTGGAACCCCC 500

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_079614.2  CG7996-RA (snk), mRNA 
0   NM_078547.2  CG2979-RA (Yp2), mRNA 
0   NM_134645.2  CG11376-RA (CG11376), mRNA 
0   NM_078523.2  CG2252-RB, transcript variant B (fs(1)h), mRNA 
0   NM_137054.1  CG6280-RA (CG6280), mRNA 
0   NM_166580.1  CG32834-RA (CG32834), mRNA 
0   NM_138051.2  CG3362-RA (CG3362), mRNA 
0   NM_167827.1  CG7004-RC, transcript variant C (fwd), mRNA 
0   NM_167826.1  CG7004-RB, transcript variant B (fwd), mRNA 
0   NM_080083.3  CG7004-RA, transcript variant A (fwd), mRNA 
0   NM_136560.2  CG8584-RA (CG8584), mRNA 
0   NM_135908.2  CG18482-RA (CG18482), mRNA 
0   NM_001042822.1  CG34120-RC, transcript variant C (CG34120), mRNA 
0   NM_079665.2  CG7623-RA (sll), mRNA 
0   NM_001043332.1  CG2005-RE, transcript variant E (Ptp99A), mRNA 
0   NM_142957.1  CG13605-RA (CG13605), mRNA 
0   NM_166080.1  CG30081-RA (CG30081), mRNA 
0   NM_135156.2  CG13991-RA (CG13991), mRNA 
0   11  NM_166035.1  CG8367-RA, transcript variant A (cg), mRNA 
0   11  NM_166036.1  CG8367-RC, transcript variant C (cg), mRNA 
0   11  NM_079014.2  CG8367-RD, transcript variant D (cg), mRNA 
0   11  NM_166034.1  CG8367-RB, transcript variant B (cg), mRNA 
0   NM_142943.2  CG13603-RA (CG13603), mRNA 
0   NM_135090.2  CG7277-RA (CG7277), mRNA 
0   NM_080198.2  CG5650-RA (Pp1-87B), mRNA 
0   NM_165153.1  CG31817-RA (CG31817), mRNA 
0   NM_134624.2  CG17598-RA (CG17598), mRNA 
0   NM_057586.3  CG9155-RD, transcript variant D (Myo61F), mRNA 
0   NM_167870.1  CG9155-RA, transcript variant A (Myo61F), mRNA 
0   NM_167871.1  CG9155-RB, transcript variant B (Myo61F), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.