National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 7978R-3 
 Symbol Ac76E  Full Name Adenylyl cyclase 76E 
 CG No CG7978  Old CG No CG7978 
 Synonyms CG7978, AC 76E, DAC76E, DAC2, Ac76E 
 Accession No (Link to NCBI) NM_079449.2 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Umetsu D, Dunst S, Dahmann C.
An RNA interference screen for genes required to shape the anteroposterior compartment boundary in Drosophila identifies the Eph receptor.
PLoS ONE (2014) 9(12) e114340 [ PubMed ID = 25473846 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgGGGCAATGGCACAAATGCAAC 
 Primer Seq. 3'
aatctagaggtaccAGTGGATGCACAGGAAGAGGG 
 Predicted Fragment Size
494 
 IR fragment full Seq
0001 GGGCAATGGC ACAAATGCAA CAGCGAATCT GATTGTTAAG GCCGACGGAA ATGCAACgNA 
0061 GCCGAAGGNG atNACGTCAT CGGCGGCCAG GATGAATGAC GCCCTTTCGG CATCTTTGGC 
0121 CGATTNTGAG CGAGCAGGAA AATGGAACCA CGGCTGAGGA CATCCACCTA NACGATTTGT 
0181 ATACCCGCTA CCGCCAGAGG CTCCGCAAGT CGCTTTTCNA GATCGGGATT GTTAACTTCG 
0241 CTGCTGGCAT GTGTTGTGTC CATAATAATT GGCATCGTAT TACGGTCAGN ACCTGGTGCA 
0301 GACCATGCTC TTAGTCCTGG CTGCCCTAAT CTCGGGATCC ATTCTCACGG CCCTGCAGTT 
0361 cCCGGCGGTG CTGAGCTNCC NGGCAGCCGC CNNGGcNTTC GCCATCGTCA CCACCTTCTC 
0421 ACTGGGCACC ATTGCGGCCA TCACCGGGGA CGAACTGGCT CCCCTGCCCA TGTACGCCCT 
0481 CTTcCTGTGC ATCCACT 
 in silico PCR Fragment
0001 GGGCAATGGC ACAAATGCAA CAGCGAATCT GATTGTTAAG GCCGACGGAA ATGCAACGCA 
0061 GCCGAAGGCG ATGACGTCAT CGGCGGCCAG GATGAATGAC GCCCTTTCGG CATCTTTGGC 
0121 CGATT-TGAG CGAGCAGGAA AATGGAACCA CGGCTGAGGA CATCCACCTA AACGATTTGT 
0181 ATACCCGCTA CCGCCAGAGG CTCCGCAAGT CGCTTTTC-A GATCGGGATT GTTAACTTCG 
0241 CTGCTGGCAT GTGTTGTGTC CATAATAATT GGCATCGT-T TACGGCCAGC ACCTGGTGCA 
0301 GACCATGCTC TTAGTCCTGG CTGCCCTAAT CTCGGGATCC ATTCTCACGG CCCTGCAGTT 
0361 CCCGGCGGTG CTGAGCTCCC CGGCAGCCGC CTTGGCCTTC GCCATCGTCA CCACCTTCTC 
0421 ACTGGGCACC ATTGCGGCCA TCACCGGGGA CGAACTGGCT CCCCTGCCCA TGTACGCCCT 
0481 CTTCCTGTGC ATCCACT 
 Assemble Data

7978R-3.IR_full       1   GGGCAATGGCACAAATGCAACAGCGAATCTGATTGTTAAGGCCGACGGAAATGCAACGNA 60
                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
7978R-3.in silico     1   GGGCAATGGCACAAATGCAACAGCGAATCTGATTGTTAAGGCCGACGGAAATGCAACGCA 60


7978R-3.IR_full       61  GCCGAAGGNGATNACGTCATCGGCGGCCAGGATGAATGACGCCCTTTCGGCATCTTTGGC 120
                          |||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||
7978R-3.in silico     61  GCCGAAGGCGATGACGTCATCGGCGGCCAGGATGAATGACGCCCTTTCGGCATCTTTGGC 120


7978R-3.IR_full       121 CGATTNTGAGCGAGCAGGAAAATGGAACCACGGCTGAGGACATCCACCTANACGATTTGT 180
                          ||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||
7978R-3.in silico     121 CGATT-TGAGCGAGCAGGAAAATGGAACCACGGCTGAGGACATCCACCTAAACGATTTGT 180


7978R-3.IR_full       181 ATACCCGCTACCGCCAGAGGCTCCGCAAGTCGCTTTTCNAGATCGGGATTGTTAACTTCG 240
                          |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||
7978R-3.in silico     181 ATACCCGCTACCGCCAGAGGCTCCGCAAGTCGCTTTTC-AGATCGGGATTGTTAACTTCG 240


7978R-3.IR_full       241 CTGCTGGCATGTGTTGTGTCCATAATAATTGGCATCGTATTACGGTCAGNACCTGGTGCA 300
                          |||||||||||||||||||||||||||||||||||||| |||||| ||| ||||||||||
7978R-3.in silico     241 CTGCTGGCATGTGTTGTGTCCATAATAATTGGCATCGT-TTACGGCCAGCACCTGGTGCA 300


7978R-3.IR_full       301 GACCATGCTCTTAGTCCTGGCTGCCCTAATCTCGGGATCCATTCTCACGGCCCTGCAGTT 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7978R-3.in silico     301 GACCATGCTCTTAGTCCTGGCTGCCCTAATCTCGGGATCCATTCTCACGGCCCTGCAGTT 360


7978R-3.IR_full       361 CCCGGCGGTGCTGAGCTNCCNGGCAGCCGCCNNGGCNTTCGCCATCGTCACCACCTTCTC 420
                          ||||||||||||||||| || ||||||||||  ||| |||||||||||||||||||||||
7978R-3.in silico     361 CCCGGCGGTGCTGAGCTCCCCGGCAGCCGCCTTGGCCTTCGCCATCGTCACCACCTTCTC 420


7978R-3.IR_full       421 ACTGGGCACCATTGCGGCCATCACCGGGGACGAACTGGCTCCCCTGCCCATGTACGCCCT 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7978R-3.in silico     421 ACTGGGCACCATTGCGGCCATCACCGGGGACGAACTGGCTCCCCTGCCCATGTACGCCCT 480


7978R-3.IR_full       481 CTTCCTGTGCATCCACT 497
                          |||||||||||||||||
7978R-3.in silico     481 CTTCCTGTGCATCCACT 497

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   476  NM_079449.2  CG7978-RA (Ac76E), mRNA 
28.15   134  NM_168827.1  CG32219-RA (CG32219), mRNA 
0   NM_137628.1  CG13868-RA (CG13868), mRNA 
0   10  NM_135440.1  CG4450-RA (CG4450), mRNA 
0   NM_139680.1  CG17150-RA, transcript variant A (CG17150), mRNA 
0   NM_141337.1  CG2031-RA (Hpr1), mRNA 
0   NM_136233.2  CG9273-RA (CG9273), mRNA 
0   NM_169386.1  CG17228-RA, transcript variant A (pros), mRNA 
0   NM_176459.1  CG17228-RD, transcript variant D (pros), mRNA 
0   NM_079593.3  CG17228-RC, transcript variant C (pros), mRNA 
0   NM_135508.2  CG5739-RA (CG5739), mRNA 
0   NM_130478.2  CG2995-RA (CG2995), mRNA 
0   NM_135248.1  CG13776-RA (CG13776), mRNA 
0   NM_140438.2  CG32139-RA (Sox21b), mRNA 
0   NM_168107.1  CG17150-RC, transcript variant C (CG17150), mRNA 
0   NM_176339.1  CG9674-RD, transcript variant D (CG9674), mRNA 
0   NM_140665.1  CG9674-RA, transcript variant A (CG9674), mRNA 
0   NM_168156.1  CG7018-RA, transcript variant A (Ets65A), mRNA 
0   NM_168686.1  CG9674-RB, transcript variant B (CG9674), mRNA 
0   NM_168687.1  CG9674-RC, transcript variant C (CG9674), mRNA 
0   NM_142158.1  CG6966-RA (CG6966), mRNA 
0   NM_132993.2  CG8465-RA, transcript variant A (l(1)G0222), mRNA 
0   NM_167569.1  CG8465-RB, transcript variant B (l(1)G0222), mRNA 
0   NM_167570.1  CG8465-RC, transcript variant C (l(1)G0222), mRNA 
0   NM_135171.2  CG9498-RA (CG9498), mRNA 
0   NM_167399.4  CG12047-RB, transcript variant B (mud), mRNA 
0   17  NM_153771.2  CG8920-RC, transcript variant C (CG8920), mRNA 
0   14  NM_137630.2  CG8920-RA, transcript variant A (CG8920), mRNA 
0   14  NM_137631.5  CG8920-RB, transcript variant B (CG8920), mRNA 
0   NM_166067.1  CG10151-RA, transcript variant A (CG10151), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.