National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 7952R-1 
 Symbol gt  Full Name giant 
 CG No CG7952  Old CG No CG7952 
 Synonyms Giant, EG:BACH7M4.5, CG7952, GIAN_DROME, l(1)giant, l(1)3Aa, gt, Gt 
 Accession No (Link to NCBI) NM_080310.2 
 Inserted Chr.
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
[Please submit your publication]
Bauke AC, Sasse S, Matzat T, Klämbt C.
A transcriptional network controlling glial development in the Drosophila visual system.
Development (2015) 142(12) 2184-93 [ PubMed ID = 26015542 ] [ RRC reference ]

Nitta Y, Yamazaki D, Sugie A, Hiroi M, Tabata T.
DISCO Interacting Protein 2 regulates axonal bifurcation and guidance of Drosophila mushroom body neurons.
Dev. Biol. (2017) 421(2) 233-244 [ PubMed ID = 27908785 ] [ RRC reference ]

Umetsu D, Dunst S, Dahmann C.
An RNA interference screen for genes required to shape the anteroposterior compartment boundary in Drosophila identifies the Eph receptor.
PLoS ONE (2014) 9(12) e114340 [ PubMed ID = 25473846 ] [ RRC reference ]  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                          ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| silico     1   CCCTGATGCACCACCACCAGTACCAGCACCACCAGCAGCAACCACTGCACCACTTGCCGC 60

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     61  ACAGCCAATTGCCGGTTCAGGGATCCTTGGGCCTACCCAAAATGGATCTGTACACGGCCT 120

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     121 ACGCCTACCAGCAGCAGTTGCTGGGAGCTGCCCTCAGTCAGCAGCAACAACAGCAACAGC 180

                          |||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||| silico     181 AGCAGCAGCAACATCA-GCAGCTGCAGCAGCAGCATA-CCTCCTCTGCAGAGGTCCTGGA 240

                          |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| silico     241 TCTTTCCCGTCGATGTGACAGCGTAGAGACACCCAGGAAGACTCCCTCGCCGTATCAAAC 300

                          |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     301 AAGCTATAGCTACGGCAGTGGTTCCCCCTCGGCTTCGCCCACCAGCAATCTTCTGTATGC 360

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     361 CGCCCAAATGCAACAGCAGCAACATCAGCAGCAACAACAGCAACAGCAGCAGCAGCAACA 420

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     421 ATTAGCCTCCCTGTATCCCGCTTTTTACTACAGCAACATCAAGCAGGAGCAAGCCACGCC 480

7952R-1.IR_full       481 CACTGCTGCTCCGCCCAAGGTT 502
                          |||||||||||||||||||||| silico     481 CACTGCTGCTCCGCCCAAGGTT 502

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
107.88  520  14  146  595  NM_080310.2  CG7952-RB (gt), mRNA 
13.69   66  1049  3289  6829  NM_167335.1  CG4013-RC, transcript variant C (Smr), mRNA 
13.69   66  1049  3289  6829  NM_167334.1  CG4013-RB, transcript variant B (Smr), mRNA 
13.69   66  1049  3289  6829  NM_080536.2  CG4013-RA, transcript variant A (Smr), mRNA 
11.61   56  308  1293  3000  NM_080376.1  CG8118-RA, transcript variant A (mam), mRNA 
11.61   56  308  1293  3000  NM_166030.1  CG8118-RB, transcript variant B (mam), mRNA 
9.95   48  326  1069  2687  NM_168571.2  CG32133-RA (CG32133), mRNA 
8.5   41  159  645  1581  NM_057771.2  CG1864-RB, transcript variant B (Hr38), mRNA 
8.29   40  208  964  1969  NM_139493.2  CG2083-RA (CG2083), mRNA 
7.88   38  148  703  1654  NM_206286.1  CG10107-RC, transcript variant C (CG10107), mRNA 
7.88   38  148  703  1654  NM_139799.3  CG10107-RA, transcript variant A (CG10107), mRNA 
7.46   36  190  740  1424  NM_134474.4  CG32532-RA (CG32532), mRNA 
7.05   34  172  671  1459  NM_176592.1  CG12071-RB, transcript variant B (CG12071), mRNA 
7.05   34  172  671  1459  NM_143575.2  CG12071-RA, transcript variant A (CG12071), mRNA 
7.05   34  171  541  1195  NM_170628.1  CG7391-RB, transcript variant B (Clk), mRNA 
7.05   34  171  541  1195  NM_206299.1  CG7391-RC, transcript variant C (Clk), mRNA 
7.05   34  171  541  1195  NM_079240.2  CG7391-RA, transcript variant A (Clk), mRNA 
7.05   34  171  541  1195  NM_001014574.1  CG7391-RF, transcript variant F (Clk), mRNA 
7.05   34  171  541  1195  NM_001014575.1  CG7391-RE, transcript variant E (Clk), mRNA 
7.05   34  171  541  1195  NM_001014576.1  CG7391-RD, transcript variant D (Clk), mRNA 
6.63   32  103  448  1092  NM_206620.4  CG32782-RD, transcript variant D (tlk), mRNA 
6.63   32  103  448  1092  NM_130717.3  CG32782-RC, transcript variant C (tlk), mRNA 
6.43   31  174  741  1956  NM_169783.1  CG31243-RB, transcript variant B (cpo), mRNA 
6.43   31  174  741  1952  NM_169781.1  CG31243-RE, transcript variant E (cpo), mRNA 
6.43   31  174  741  1952  NM_169782.1  CG31243-RA, transcript variant A (cpo), mRNA 
6.43   31  138  568  1536  NM_080105.2  CG31243-RF, transcript variant F (cpo), mRNA 
6.22   30  215  643  1557  NM_132246.2  CG10555-RA (CG10555), mRNA 
6.22   30  142  489  1100  NM_167200.1  CG1343-RB, transcript variant B (Sp1), mRNA 
6.22   30  142  489  1100  NM_132351.1  CG1343-RA, transcript variant A (Sp1), mRNA 
6.01   29  118  485  1086  NM_132004.2  CG4136-RA (CG4136), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.