National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 7952R-1 
 Symbol gt  Full Name giant 
 CG No CG7952  Old CG No CG7952 
 Synonyms Giant, EG:BACH7M4.5, CG7952, GIAN_DROME, l(1)giant, l(1)3Aa, gt, Gt 
 Accession No (Link to NCBI) NM_080310.2 
 Inserted Chr.
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Bauke AC, Sasse S, Matzat T, Klämbt C.
A transcriptional network controlling glial development in the Drosophila visual system.
Development (2015) 142(12) 2184-93 [ PubMed ID = 26015542 ] [ RRC reference ]

Umetsu D, Dunst S, Dahmann C.
An RNA interference screen for genes required to shape the anteroposterior compartment boundary in Drosophila identifies the Eph receptor.
PLoS ONE (2014) 9(12) e114340 [ PubMed ID = 25473846 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgCCCTGATGCACCACCACCAGT 
 Primer Seq. 3'
aatctagaggtaccAACCTTGGGCGGAGCAGCAGT 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 CCCTGATGCA CCACCACCAG TACCAGCACC ACCAGCAGCA ACCGCTGCAC CACTTGCCGC 
0061 ACAGCCAATT GCCGGTTCAG GGATCCTTGG GCCTACCCAA AATGGATCTG TACACGGCCT 
0121 ACGCCTACCA GCAGCAGTTG CTGGGAGCTG CCCTCAGTCA GCAGCAACAA CAGCAACAGC 
0181 AGCAGCAGCA ACATCANGCA GCTGCAGCAG CAGCATATCC TCCTCTGCAG AGGTCCTGGA 
0241 TCTTTCCCGT CGATGTGACA GCGTAGAGAC GCCCAGGAAG ACTCCCTCGC CGTATCAAAC 
0301 AAGCTACAGC TACGGCAGTG GTTCCCCCTC GGCTTCGCCC ACCAGCAATC TTCTGTATGC 
0361 CGCCCAAATG CAACAGCAGC AACATCAGCA GCAACAACAG CAACAGCAGC AGCAGCAACA 
0421 ATTAGCCTCC CTGTATCCCG CTTTTTACTA CAGCAACATC AAGCAGGAGC AAGCCACGCC 
0481 CACTGCTGCT CCGCCCAAGG TT 
 in silico PCR Fragment
0001 CCCTGATGCA CCACCACCAG TACCAGCACC ACCAGCAGCA ACCACTGCAC CACTTGCCGC 
0061 ACAGCCAATT GCCGGTTCAG GGATCCTTGG GCCTACCCAA AATGGATCTG TACACGGCCT 
0121 ACGCCTACCA GCAGCAGTTG CTGGGAGCTG CCCTCAGTCA GCAGCAACAA CAGCAACAGC 
0181 AGCAGCAGCA ACATCA-GCA GCTGCAGCAG CAGCATA-CC TCCTCTGCAG AGGTCCTGGA 
0241 TCTTTCCCGT CGATGTGACA GCGTAGAGAC ACCCAGGAAG ACTCCCTCGC CGTATCAAAC 
0301 AAGCTATAGC TACGGCAGTG GTTCCCCCTC GGCTTCGCCC ACCAGCAATC TTCTGTATGC 
0361 CGCCCAAATG CAACAGCAGC AACATCAGCA GCAACAACAG CAACAGCAGC AGCAGCAACA 
0421 ATTAGCCTCC CTGTATCCCG CTTTTTACTA CAGCAACATC AAGCAGGAGC AAGCCACGCC 
0481 CACTGCTGCT CCGCCCAAGG TT 
 Assemble Data

7952R-1.IR_full       1   CCCTGATGCACCACCACCAGTACCAGCACCACCAGCAGCAACCGCTGCACCACTTGCCGC 60
                          ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||
7952R-1.in silico     1   CCCTGATGCACCACCACCAGTACCAGCACCACCAGCAGCAACCACTGCACCACTTGCCGC 60


7952R-1.IR_full       61  ACAGCCAATTGCCGGTTCAGGGATCCTTGGGCCTACCCAAAATGGATCTGTACACGGCCT 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7952R-1.in silico     61  ACAGCCAATTGCCGGTTCAGGGATCCTTGGGCCTACCCAAAATGGATCTGTACACGGCCT 120


7952R-1.IR_full       121 ACGCCTACCAGCAGCAGTTGCTGGGAGCTGCCCTCAGTCAGCAGCAACAACAGCAACAGC 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7952R-1.in silico     121 ACGCCTACCAGCAGCAGTTGCTGGGAGCTGCCCTCAGTCAGCAGCAACAACAGCAACAGC 180


7952R-1.IR_full       181 AGCAGCAGCAACATCANGCAGCTGCAGCAGCAGCATATCCTCCTCTGCAGAGGTCCTGGA 240
                          |||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||
7952R-1.in silico     181 AGCAGCAGCAACATCA-GCAGCTGCAGCAGCAGCATA-CCTCCTCTGCAGAGGTCCTGGA 240


7952R-1.IR_full       241 TCTTTCCCGTCGATGTGACAGCGTAGAGACGCCCAGGAAGACTCCCTCGCCGTATCAAAC 300
                          |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||
7952R-1.in silico     241 TCTTTCCCGTCGATGTGACAGCGTAGAGACACCCAGGAAGACTCCCTCGCCGTATCAAAC 300


7952R-1.IR_full       301 AAGCTACAGCTACGGCAGTGGTTCCCCCTCGGCTTCGCCCACCAGCAATCTTCTGTATGC 360
                          |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||
7952R-1.in silico     301 AAGCTATAGCTACGGCAGTGGTTCCCCCTCGGCTTCGCCCACCAGCAATCTTCTGTATGC 360


7952R-1.IR_full       361 CGCCCAAATGCAACAGCAGCAACATCAGCAGCAACAACAGCAACAGCAGCAGCAGCAACA 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7952R-1.in silico     361 CGCCCAAATGCAACAGCAGCAACATCAGCAGCAACAACAGCAACAGCAGCAGCAGCAACA 420


7952R-1.IR_full       421 ATTAGCCTCCCTGTATCCCGCTTTTTACTACAGCAACATCAAGCAGGAGCAAGCCACGCC 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7952R-1.in silico     421 ATTAGCCTCCCTGTATCCCGCTTTTTACTACAGCAACATCAAGCAGGAGCAAGCCACGCC 480


7952R-1.IR_full       481 CACTGCTGCTCCGCCCAAGGTT 502
                          ||||||||||||||||||||||
7952R-1.in silico     481 CACTGCTGCTCCGCCCAAGGTT 502

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
107.88  520  14  146  595  NM_080310.2  CG7952-RB (gt), mRNA 
13.69   66  1049  3289  6829  NM_167335.1  CG4013-RC, transcript variant C (Smr), mRNA 
13.69   66  1049  3289  6829  NM_167334.1  CG4013-RB, transcript variant B (Smr), mRNA 
13.69   66  1049  3289  6829  NM_080536.2  CG4013-RA, transcript variant A (Smr), mRNA 
11.61   56  308  1293  3000  NM_080376.1  CG8118-RA, transcript variant A (mam), mRNA 
11.61   56  308  1293  3000  NM_166030.1  CG8118-RB, transcript variant B (mam), mRNA 
9.95   48  326  1069  2687  NM_168571.2  CG32133-RA (CG32133), mRNA 
8.5   41  159  645  1581  NM_057771.2  CG1864-RB, transcript variant B (Hr38), mRNA 
8.29   40  208  964  1969  NM_139493.2  CG2083-RA (CG2083), mRNA 
7.88   38  148  703  1654  NM_206286.1  CG10107-RC, transcript variant C (CG10107), mRNA 
7.88   38  148  703  1654  NM_139799.3  CG10107-RA, transcript variant A (CG10107), mRNA 
7.46   36  190  740  1424  NM_134474.4  CG32532-RA (CG32532), mRNA 
7.05   34  172  671  1459  NM_176592.1  CG12071-RB, transcript variant B (CG12071), mRNA 
7.05   34  172  671  1459  NM_143575.2  CG12071-RA, transcript variant A (CG12071), mRNA 
7.05   34  171  541  1195  NM_170628.1  CG7391-RB, transcript variant B (Clk), mRNA 
7.05   34  171  541  1195  NM_206299.1  CG7391-RC, transcript variant C (Clk), mRNA 
7.05   34  171  541  1195  NM_079240.2  CG7391-RA, transcript variant A (Clk), mRNA 
7.05   34  171  541  1195  NM_001014574.1  CG7391-RF, transcript variant F (Clk), mRNA 
7.05   34  171  541  1195  NM_001014575.1  CG7391-RE, transcript variant E (Clk), mRNA 
7.05   34  171  541  1195  NM_001014576.1  CG7391-RD, transcript variant D (Clk), mRNA 
6.63   32  103  448  1092  NM_206620.4  CG32782-RD, transcript variant D (tlk), mRNA 
6.63   32  103  448  1092  NM_130717.3  CG32782-RC, transcript variant C (tlk), mRNA 
6.43   31  174  741  1956  NM_169783.1  CG31243-RB, transcript variant B (cpo), mRNA 
6.43   31  174  741  1952  NM_169781.1  CG31243-RE, transcript variant E (cpo), mRNA 
6.43   31  174  741  1952  NM_169782.1  CG31243-RA, transcript variant A (cpo), mRNA 
6.43   31  138  568  1536  NM_080105.2  CG31243-RF, transcript variant F (cpo), mRNA 
6.22   30  215  643  1557  NM_132246.2  CG10555-RA (CG10555), mRNA 
6.22   30  142  489  1100  NM_167200.1  CG1343-RB, transcript variant B (Sp1), mRNA 
6.22   30  142  489  1100  NM_132351.1  CG1343-RA, transcript variant A (Sp1), mRNA 
6.01   29  118  485  1086  NM_132004.2  CG4136-RA (CG4136), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.