National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 7921R-1 
 Symbol Mgat2  Full Name Mgat2 
 CG No CG7921  Old CG No CG7921 
 Synonyms dMGAT2, CG7921, GlcNAc-TII, Mgat2 
 Accession No (Link to NCBI)  
 Inserted Chr. ll 
 Insertional Mutation  lethal 
 Phenotype induced by Act5C-GAL4 at 28 degrees early pupal lethal 
 Map Viewer
 Reference
[Please submit your publication]
Yamamoto-Hino M, Yoshida H, Ichimiya T, Sakamura S, Maeda M, Kimura Y, Sasaki N, Aoki-Kinoshita KF, Kinoshita-Toyoda A, Toyoda H, Ueda R, Nishihara S, Goto S.
Phenotype-based clustering of glycosylation-related genes by RNAi-mediated gene silencing.
Genes Cells (2015) 20(6) 521-42 [ PubMed ID = 25940448 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgTCCGACACCAGCAATAACGAG 
 Primer Seq. 3'
aatctagaggtaccGCACAGCTCGTGATCCCGCAT 
 Predicted Fragment Size
516 
 IR fragment full Seq
 
 in silico PCR Fragment
 
 Assemble Data

7921R-1.IR full       1   TCCGACACCAGCAATAACGAGCAAAGTAGCCATAGCAGCAGCAAAAATGGTGCACAAACA 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7921R-1.in silico     1   TCCGACACCAGCAATAACGAGCAAAGTAGCCATAGCAGCAGCAAAAATGGTGCACAAACA 60


7921R-1.IR full       61  TGGAACTATCATGTCCTGCCGTCATTGTATTCCGTCTATCAGAAGGTGGAGGTCATGCCC 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7921R-1.in silico     61  TGGAACTATCATGTCCTGCCGTCATTGTATTCCGTCTATCAGAAGGTGGAGGTCATGCCC 120


7921R-1.IR full       121 TGGGTCAGCAGCAAGCACAACATGGGCTTCGCCTTCAATCGCACCACCTGGTCGAACATC 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7921R-1.in silico     121 TGGGTCAGCAGCAAGCACAACATGGGCTTCGCCTTCAATCGCACCACCTGGTCGAACATC 180


7921R-1.IR full       181 CGGAAATGCGCCCGCCACTTCTGCACCTACGATGACTACAACTGGGACTGGTCCTTGCAG 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7921R-1.in silico     181 CGGAAATGCGCCCGCCACTTCTGCACCTACGATGACTACAACTGGGACTGGTCCTTGCAG 240


7921R-1.IR full       241 CACGTTTCGCAGCAGTGTCTGCGGCGAAAGCTGCACGCCATGATTGTCAAGGGGCCGCGA 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7921R-1.in silico     241 CACGTTTCGCAGCAGTGTCTGCGGCGAAAGCTGCACGCCATGATTGTCAAGGGGCCGCGA 300


7921R-1.IR full       301 GTCTTCCACATCGGAGAATGCGGCGTTCATCACAAGAACAAGAACTGCGAGTCCAACCAG 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7921R-1.in silico     301 GTCTTCCACATCGGAGAATGCGGCGTTCATCACAAGAACAAGAACTGCGAGTCCAACCAG 360


7921R-1.IR full       361 GTGATCTCGAAGGTGCAGCACGTGCTGCCANTAGCCCGCAACTCGCACCAGCTCTTCCCG 420
                          ||||||||||||||||||||||||||||   |||||||||||||||||||||||||||||
7921R-1.in silico     361 GTGATCTCGAAGGTGCAGCACGTGCTGCGCATAGCCCGCAACTCGCACCAGCTCTTCCCG 420


7921R-1.IR full       421 CGCTCCCTCACCCTCACGGTGCCCAGTCTGATGAAGAAGTCGAAGCTGCGCAAAGGCAAC 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7921R-1.in silico     421 CGCTCCCTCACCCTCACGGTGCCCAGTCTGATGAAGAAGTCGAAGCTGCGCAAAGGCAAC 480


7921R-1.IR full       481 GGCGGCTGGGGCGACATGCGGGATCACGAGCTGTGC 516
                          ||||||||||||||||||||||||||||||||||||
7921R-1.in silico     481 GGCGGCTGGGGCGACATGCGGGATCACGAGCTGTGC 516

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100  498  NM_143506.3  Mgat2 CG7921-RA, transcript variant A (Mgat2), mRNA 
79.51  396  NM_001014684.1  Mgat2 CG7921-RB, transcript variant B (Mgat2), mRNA 
0.2  NM_165411.1  CG6448-RA, transcript variant A (CG6448), mRNA 
0.2  NM_136290.2  CG6448-RB, transcript variant B (CG6448), mRNA 
NM_140289.2  CG17153-RA (CG17153), mRNA 
NM_001015293.1  CG41114-PB.3 (CG41114), mRNA 
NM_001015294.1  CG41114-PA.3 (CG41114), mRNA 
NM_165850.1  Elongation factor 1alpha48D CG8280-RB, transcript variant B (Ef1alpha48D), mRNA 
NM_058027.3  Elongation factor 1alpha48D CG8280-RA, transcript variant A (Ef1alpha48D), mRNA 
NM_141442.2  CG2656-RA (CG2656), mRNA 
NM_136046.2  CG15161-RA (CG15161), mRNA 
NM_135432.1  CG13108-RA (CG13108), mRNA 
16  NM_166874.1  CG3638-RA, transcript variant A (CG3638), mRNA 
16  NM_130541.3  CG3638-RC, transcript variant C (CG3638), mRNA 
16  NM_166872.1  CG3638-RD, transcript variant D (CG3638), mRNA 
16  NM_166873.1  CG3638-RB, transcript variant B (CG3638), mRNA 
NM_079342.2  Dichaete CG5893-RA (D), mRNA 
NM_001014571.1  formin 3 CG33556-RA (form3), mRNA 
NM_141399.1  CG9727-RA (CG9727), mRNA 
NM_130497.2  Suv4-20 CG13363-RA (Suv4-20), mRNA 
NM_135607.2  CG6495-RA (CG6495), mRNA 
NM_166601.1  eIF2B-delta CG10315-RB, transcript variant B (eIF2B-delta), mRNA 
NM_166602.1  eIF2B-delta CG10315-RC, transcript variant C (eIF2B-delta), mRNA 
NM_137946.2  eIF2B-delta CG10315-RA, transcript variant A (eIF2B-delta), mRNA 
NM_139536.1  CG11505-RB, transcript variant B (CG11505), mRNA 
NM_168007.1  CG11505-RA, transcript variant A (CG11505), mRNA 
NM_169961.1  E2F transcription factor CG6376-RB, transcript variant B (E2f), mRNA 
NM_169962.1  E2F transcription factor CG6376-RC, transcript variant C (E2f), mRNA 
NM_079713.2  E2F transcription factor CG6376-RA, transcript variant A (E2f), mRNA 
NM_079950.2  Antigen 5-related 2 CG9540-RA (Ag5r2), mRNA 
100  482  NM_143506.3  Mgat2 CG7921-RA, transcript variant A (Mgat2), mRNA 
100  482  NM_001014684.1  Mgat2 CG7921-RB, transcript variant B (Mgat2), mRNA 
NM_136409.1  CG17002-RB (CG17002), mRNA 
NM_142516.1  CG14285-RA (CG14285), mRNA 
14  NM_001014642.1  munin CG33518-RA (mun), mRNA 
NM_137690.2  CG10543-RA, transcript variant A (CG10543), mRNA 
NM_176241.1  CG10543-RC, transcript variant C (CG10543), mRNA 
NM_166416.1  CG10543-RB, transcript variant B (CG10543), mRNA 
NM_057624.2  Wnt oncogene analog 4 CG4698-RA (Wnt4), mRNA 
NM_141255.2  CG12007-RA (CG12007), mRNA 
NM_136849.1  CG30035-RA, transcript variant A (CG30035), mRNA 
NM_168784.1  CG32204-RA (CG32204), mRNA 
NM_176579.1  CG33203-RC (CG33203), mRNA 
NM_143439.2  CG2010-RB, transcript variant B (CG2010), mRNA 
NM_170412.1  CG2010-RA, transcript variant A (CG2010), mRNA 
12  NM_139399.1  CG13921-RA, transcript variant A (CG13921), mRNA 
NM_206235.1  CG13921-RB, transcript variant B (CG13921), mRNA 
NM_136256.2  CG8678-RA (CG8678), mRNA 
NM_167095.1  Smg1 CG32743-RA (Smg1), mRNA 
NM_078524.2  Smad on X CG2262-RA (Smox), mRNA 
NM_143262.1  CG14254-RA (CG14254), mRNA 
10  NM_143700.3  CG17724-RA, transcript variant A (CG17724), mRNA 
NM_206603.1  CG3056-RB, transcript variant B (CG3056), mRNA 
NM_130552.2  CG3056-RA, transcript variant A (CG3056), mRNA 
NM_166957.1  CG32793-RA (CG32793), mRNA 
NM_057225.3  hook CG10653-RA (hk), mRNA 
NM_141674.2  CG9448-RA (CG9448), mRNA 
NM_140948.2  CG6680-RA, transcript variant A (CG6680), mRNA 
NM_168844.1  CG6680-RB, transcript variant B (CG6680), mRNA 
NM_144381.1  lectin-22C CG15378-RA (lectin-22C), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.