National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 7904R-3 
 Symbol put  Full Name punt 
 CG No CG7904  Old CG No CG7904 
 Synonyms atrII, CG7904, Punt, TGF-B, Atr-II, l(3)10460, STK-C, pun, TGF-beta, l(3)j5A5, dlhC, Tgf-r, AtrII, Atr, Atr88CD, Act-r, put, Put 
 Accession No (Link to NCBI) NM_169591.1 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees pupal lethal 
 Map Viewer
[Please submit your publication]
Martins T, Eusebio N, Correia A, Marinho J, Casares F, Pereira PS.
TGFβ/Activin signalling is required for ribosome biogenesis and cell growth in Drosophila salivary glands.
Open Biol (2017) 7(1) [ PubMed ID = 28123053 ] [ RRC reference ]

Tiwari P, Kumar A, Das RN, Malhotra V, VijayRaghavan K.
A Tendon Cell Specific RNAi Screen Reveals Novel Candidates Essential for Muscle Tendon Interaction.
PLoS ONE (2015) 10(10) e0140976 [ PubMed ID = 26488612 ] [ RRC reference ]

Swarup S, Pradhan-Sundd T, Verheyen EM.
Genome-wide identification of phospho-regulators of Wnt signaling in Drosophila.
Development (2015) 142(8) 1502-15 [ PubMed ID = 25852200 ] [ RRC reference ]  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                          ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| silico     1   GATCTGCTTTATCTAACGGCGCAGCTAACGCTGGTCTGCTGTCTGATTGGAATCCATGGA 60

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     61  TCTATTTTGCCCGGAAGTCATGGGATCATAGAATGCGAGCACTTCGACGAGAAGATGTGC 120

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     121 AACACAACGCAGCAATGTGAAACACGGATAGAGCACTGTAAGATGGAGGCGGATAAGTTT 180

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     181 CCCAGCTGCTATGTCCTTTGGTCGGTCAACGAGACAACGGGCATCCTGCGCATCAAGATG 240

                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     241 AAGGGCTGCTTCACGGACATGCACGAATGCAATCAGACGGAGTGCGTGACCAGTGCAGAG 300

                          ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| silico     301 CCACGGCAGGG-AAACATTCACTTCTGCTGCTGCAAGGGATCGCGGTGCAATTCCAACCA 360

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     361 GAAATATATTAAAAGCACCACGGAGGCAACCACACAAGTGCCCAAGGAGAAGACGCAGGA 420

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     421 CGGCAGCAATTTGATATACATCTACATTGGCACCTCCGTTTTCAGCGTGCTCATGGTCAT 480

7904R-3.IR_full       481 TGTTGGCATGGGCCTTCTTCT 501
                          ||||||||||||||||||||| silico     481 TGTTGGCATGGGCCTTCTTCT 501

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_169591.1  CG7904-RA (put), mRNA 
0.62   37  NM_175960.3  CG33196-RB (dp), mRNA 
0.2   NM_165676.1  CG11804-RB, transcript variant B (ced-6), mRNA 
0.2   NM_136644.2  CG11804-RC, transcript variant C (ced-6), mRNA 
0.2   NM_165675.1  CG11804-RA, transcript variant A (ced-6), mRNA 
0   NM_169203.1  CG11094-RB, transcript variant B (dsx), mRNA 
0   NM_079548.4  CG11094-RC, transcript variant C (dsx), mRNA 
0   NM_135275.2  CG5958-RA (CG5958), mRNA 
0   NM_143459.1  CG1964-RA (Kul), mRNA 
0   NM_079044.1  CG17876-RA (Amy-d), mRNA 
0   NM_080421.3  CG18730-RA (Amy-p), mRNA 
0   NM_132267.4  CG12109-RB (Caf1-180), mRNA 
0   NM_079939.2  CG5580-RA, transcript variant A (sbb), mRNA 
0   NM_206161.1  CG5580-RB, transcript variant B (sbb), mRNA 
0   NM_206162.1  CG5580-RC, transcript variant C (sbb), mRNA 
0   NM_136457.2  CG1358-RA, transcript variant A (CG1358), mRNA 
0   NM_165545.1  CG1358-RB, transcript variant B (CG1358), mRNA 
0   NM_165546.1  CG1358-RC, transcript variant C (CG1358), mRNA 
0   NM_078501.2  CG5905-RA, transcript variant A (Nep1), mRNA 
0   NM_167059.1  CG5905-RB, transcript variant B (Nep1), mRNA 
0   NM_057842.2  CG16858-RA (vkg), mRNA 
0   NM_141045.1  CG7632-RA (CG7632), mRNA 
0   NM_170168.1  CG6863-RB, transcript variant B (tok), mRNA 
0   NM_057531.3  CG6863-RA, transcript variant A (tok), mRNA 
0   NM_206758.1  CG9177-RC, transcript variant C (eIF5), mRNA 
0   NM_132870.3  CG9177-RB, transcript variant B (eIF5), mRNA 
0   NM_206757.1  CG9177-RD, transcript variant D (eIF5), mRNA 
0   NM_206754.1  CG9177-RG, transcript variant G (eIF5), mRNA 
0   NM_206756.1  CG9177-RE, transcript variant E (eIF5), mRNA 
0   NM_167477.1  CG9177-RA, transcript variant A (eIF5), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.