National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 7904R-3 
 Symbol put  Full Name punt 
 CG No CG7904  Old CG No CG7904 
 Synonyms atrII, CG7904, Punt, TGF-B, Atr-II, l(3)10460, STK-C, pun, TGF-beta, l(3)j5A5, dlhC, Tgf-r, AtrII, Atr, Atr88CD, Act-r, put, Put 
 Accession No (Link to NCBI) NM_169591.1 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees pupal lethal 
 Map Viewer
 Reference
[Please submit your publication]
Martins T, Eusebio N, Correia A, Marinho J, Casares F, Pereira PS.
TGFβ/Activin signalling is required for ribosome biogenesis and cell growth in Drosophila salivary glands.
Open Biol (2017) 7(1) [ PubMed ID = 28123053 ] [ RRC reference ]

Swarup S, Pradhan-Sundd T, Verheyen EM.
Genome-wide identification of phospho-regulators of Wnt signaling in Drosophila.
Development (2015) 142(8) 1502-15 [ PubMed ID = 25852200 ] [ RRC reference ]

Tiwari P, Kumar A, Das RN, Malhotra V, VijayRaghavan K.
A Tendon Cell Specific RNAi Screen Reveals Novel Candidates Essential for Muscle Tendon Interaction.
PLoS ONE (2015) 10(10) e0140976 [ PubMed ID = 26488612 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgGATCTGCTTTATCTAACGGCG 
 Primer Seq. 3'
aatctagaggtaccAGAAGAAGGCCCATGCCAACA 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 GATCTGcTTT ATCTAACGGC GCAgcNAACG CTGGTCTGCT GTCTGATTGG AATCCATGGA 
0061 TCTATTTTGC CCGGAAGTCA TGGGATCATA GAATGCGAGC ACTTCGACGA GAAGATGTGC 
0121 AACACAACGC AGCAATGTGA AACACGGATA GAGCACTGTA AGATGGAGGC GGATAAGTTT 
0181 CCCAGCTGCT ATGTCCTTTG GTCGGTCAAC GAGACAACGG GCATCCTGCG CATCAAGATG 
0241 AAGGGCTGCT TCACGGACAT GCACGAATGC AATCAGACGG AGTGCGTGAC CAGTGCAGAN 
0301 CCACGGCAGG GNAAACATTC ACTTCTGCTG CTGCAAGGGA TCGCGGTGCA ATTCCAACCA 
0361 GAAATATATT AAAAGCACCA CGGAGGCAAC CACACAAGTG CCCAAGGAGA AGACGCAGGA 
0421 CGGCAGCAAT TTGATATACA TCTACATTGG CACCTCCGTT TTCAGCGTGC TCATGGTCAT 
0481 TGTTGGCATG GGCCTTCTTC T 
 in silico PCR Fragment
0001 GATCTGCTTT ATCTAACGGC GCAGCTAACG CTGGTCTGCT GTCTGATTGG AATCCATGGA 
0061 TCTATTTTGC CCGGAAGTCA TGGGATCATA GAATGCGAGC ACTTCGACGA GAAGATGTGC 
0121 AACACAACGC AGCAATGTGA AACACGGATA GAGCACTGTA AGATGGAGGC GGATAAGTTT 
0181 CCCAGCTGCT ATGTCCTTTG GTCGGTCAAC GAGACAACGG GCATCCTGCG CATCAAGATG 
0241 AAGGGCTGCT TCACGGACAT GCACGAATGC AATCAGACGG AGTGCGTGAC CAGTGCAGAG 
0301 CCACGGCAGG G-AAACATTC ACTTCTGCTG CTGCAAGGGA TCGCGGTGCA ATTCCAACCA 
0361 GAAATATATT AAAAGCACCA CGGAGGCAAC CACACAAGTG CCCAAGGAGA AGACGCAGGA 
0421 CGGCAGCAAT TTGATATACA TCTACATTGG CACCTCCGTT TTCAGCGTGC TCATGGTCAT 
0481 TGTTGGCATG GGCCTTCTTC T 
 Assemble Data

7904R-3.IR_full       1   GATCTGCTTTATCTAACGGCGCAGCNAACGCTGGTCTGCTGTCTGATTGGAATCCATGGA 60
                          ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||
7904R-3.in silico     1   GATCTGCTTTATCTAACGGCGCAGCTAACGCTGGTCTGCTGTCTGATTGGAATCCATGGA 60


7904R-3.IR_full       61  TCTATTTTGCCCGGAAGTCATGGGATCATAGAATGCGAGCACTTCGACGAGAAGATGTGC 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7904R-3.in silico     61  TCTATTTTGCCCGGAAGTCATGGGATCATAGAATGCGAGCACTTCGACGAGAAGATGTGC 120


7904R-3.IR_full       121 AACACAACGCAGCAATGTGAAACACGGATAGAGCACTGTAAGATGGAGGCGGATAAGTTT 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7904R-3.in silico     121 AACACAACGCAGCAATGTGAAACACGGATAGAGCACTGTAAGATGGAGGCGGATAAGTTT 180


7904R-3.IR_full       181 CCCAGCTGCTATGTCCTTTGGTCGGTCAACGAGACAACGGGCATCCTGCGCATCAAGATG 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7904R-3.in silico     181 CCCAGCTGCTATGTCCTTTGGTCGGTCAACGAGACAACGGGCATCCTGCGCATCAAGATG 240


7904R-3.IR_full       241 AAGGGCTGCTTCACGGACATGCACGAATGCAATCAGACGGAGTGCGTGACCAGTGCAGAN 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| 
7904R-3.in silico     241 AAGGGCTGCTTCACGGACATGCACGAATGCAATCAGACGGAGTGCGTGACCAGTGCAGAG 300


7904R-3.IR_full       301 CCACGGCAGGGNAAACATTCACTTCTGCTGCTGCAAGGGATCGCGGTGCAATTCCAACCA 360
                          ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||
7904R-3.in silico     301 CCACGGCAGGG-AAACATTCACTTCTGCTGCTGCAAGGGATCGCGGTGCAATTCCAACCA 360


7904R-3.IR_full       361 GAAATATATTAAAAGCACCACGGAGGCAACCACACAAGTGCCCAAGGAGAAGACGCAGGA 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7904R-3.in silico     361 GAAATATATTAAAAGCACCACGGAGGCAACCACACAAGTGCCCAAGGAGAAGACGCAGGA 420


7904R-3.IR_full       421 CGGCAGCAATTTGATATACATCTACATTGGCACCTCCGTTTTCAGCGTGCTCATGGTCAT 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7904R-3.in silico     421 CGGCAGCAATTTGATATACATCTACATTGGCACCTCCGTTTTCAGCGTGCTCATGGTCAT 480


7904R-3.IR_full       481 TGTTGGCATGGGCCTTCTTCT 501
                          |||||||||||||||||||||
7904R-3.in silico     481 TGTTGGCATGGGCCTTCTTCT 501

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_169591.1  CG7904-RA (put), mRNA 
0.62   37  NM_175960.3  CG33196-RB (dp), mRNA 
0.2   NM_165676.1  CG11804-RB, transcript variant B (ced-6), mRNA 
0.2   NM_136644.2  CG11804-RC, transcript variant C (ced-6), mRNA 
0.2   NM_165675.1  CG11804-RA, transcript variant A (ced-6), mRNA 
0   NM_169203.1  CG11094-RB, transcript variant B (dsx), mRNA 
0   NM_079548.4  CG11094-RC, transcript variant C (dsx), mRNA 
0   NM_135275.2  CG5958-RA (CG5958), mRNA 
0   NM_143459.1  CG1964-RA (Kul), mRNA 
0   NM_079044.1  CG17876-RA (Amy-d), mRNA 
0   NM_080421.3  CG18730-RA (Amy-p), mRNA 
0   NM_132267.4  CG12109-RB (Caf1-180), mRNA 
0   NM_079939.2  CG5580-RA, transcript variant A (sbb), mRNA 
0   NM_206161.1  CG5580-RB, transcript variant B (sbb), mRNA 
0   NM_206162.1  CG5580-RC, transcript variant C (sbb), mRNA 
0   NM_136457.2  CG1358-RA, transcript variant A (CG1358), mRNA 
0   NM_165545.1  CG1358-RB, transcript variant B (CG1358), mRNA 
0   NM_165546.1  CG1358-RC, transcript variant C (CG1358), mRNA 
0   NM_078501.2  CG5905-RA, transcript variant A (Nep1), mRNA 
0   NM_167059.1  CG5905-RB, transcript variant B (Nep1), mRNA 
0   NM_057842.2  CG16858-RA (vkg), mRNA 
0   NM_141045.1  CG7632-RA (CG7632), mRNA 
0   NM_170168.1  CG6863-RB, transcript variant B (tok), mRNA 
0   NM_057531.3  CG6863-RA, transcript variant A (tok), mRNA 
0   NM_206758.1  CG9177-RC, transcript variant C (eIF5), mRNA 
0   NM_132870.3  CG9177-RB, transcript variant B (eIF5), mRNA 
0   NM_206757.1  CG9177-RD, transcript variant D (eIF5), mRNA 
0   NM_206754.1  CG9177-RG, transcript variant G (eIF5), mRNA 
0   NM_206756.1  CG9177-RE, transcript variant E (eIF5), mRNA 
0   NM_167477.1  CG9177-RA, transcript variant A (eIF5), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.