National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 7904R-2 
 Symbol put  Full Name punt 
 CG No CG7904  Old CG No CG7904 
 Synonyms atrII, CG7904, Punt, TGF-B, Atr-II, l(3)10460, STK-C, pun, TGF-beta, l(3)j5A5, dlhC, Tgf-r, AtrII, Atr, Atr88CD, Act-r, put, Put 
 Accession No (Link to NCBI) NM_169591.1 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
[Please submit your publication]
Le V, Anderson E, Akiyama T, Wharton KA.
Drosophila models of FOP provide mechanistic insight.
Bone (2018) 109 192-200 [ PubMed ID = 29128351 ] [ RRC reference ]

Le VQ, Wharton KA.
Hyperactive BMP signaling induced by ALK2(R206H) requires type II receptor function in a Drosophila model for classic fibrodysplasia ossificans progressiva.
Dev. Dyn. (2012) 241(1) 200-14 [ PubMed ID = 22174087 ] [ RRC reference ]

Li Z, Zhang Y, Han L, Shi L, Lin X.
Trachea-derived dpp controls adult midgut homeostasis in Drosophila.
Dev. Cell (2013) 24(2) 133-43 [ PubMed ID = 23369712 ] [ RRC reference ]

Ma H, Zhao H, Liu F, Zhao H, Kong R, Shi L, Wei M, Li Z.
Heparan sulfate negatively regulates intestinal stem cell proliferation in Drosophila adult midgut.
Biol Open (2019) 8(10) [ PubMed ID = 31628141 ] [ RRC reference ]

Boulanger A, Farge M, Ramanoudjame C, Wharton K, Dura JM.
Drosophila motor neuron retraction during metamorphosis is mediated by inputs from TGF-β/BMP signaling and orphan nuclear receptors.
PLoS ONE (2012) 7(7) e40255 [ PubMed ID = 22792255 ] [ RRC reference ]

Xu R, Li J, Zhao H, Kong R, Wei M, Shi L, Bai G, Li Z.
Self-restrained regulation of stem cell niche activity by niche components in the Drosophila testis.
Dev. Biol. (2018) 439(1) 42-51 [ PubMed ID = 29679558 ] [ RRC reference ]

Hevia CF, de Celis JF.
Activation and function of TGFβ signalling during Drosophila wing development and its interactions with the BMP pathway.
Dev. Biol. (2013) 377(1) 138-53 [ PubMed ID = 23485686 ] [ RRC reference ]

Swarup S, Pradhan-Sundd T, Verheyen EM.
Genome-wide identification of phospho-regulators of Wnt signaling in Drosophila.
Development (2015) 142(8) 1502-15 [ PubMed ID = 25852200 ] [ RRC reference ]

Umetsu D, Dunst S, Dahmann C.
An RNA interference screen for genes required to shape the anteroposterior compartment boundary in Drosophila identifies the Eph receptor.
PLoS ONE (2014) 9(12) e114340 [ PubMed ID = 25473846 ] [ RRC reference ]

Umemori M, Habara O, Iwata T, Maeda K, Nishinoue K, Okabe A, Takemura M, Takahashi K, Saigo K, Ueda R, Adachi-Yamada T.
RNAi-mediated knockdown showing impaired cell survival in Drosophila wing imaginal disc.
Gene Regul Syst Bio (2009) 3 11-20 [ PubMed ID = 19838331 ] [ RRC reference ]

Tiwari P, Kumar A, Das RN, Malhotra V, VijayRaghavan K.
A Tendon Cell Specific RNAi Screen Reveals Novel Candidates Essential for Muscle Tendon Interaction.
PLoS ONE (2015) 10(10) e0140976 [ PubMed ID = 26488612 ] [ RRC reference ]  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                          ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| silico     1   GATCTGCTTTATCTAACGGCGCAGCTAACGCTGGTCTGCTGTCTGATTGGAATCCATGGA 60

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     61  TCTATTTTGCCCGGAAGTCATGGGATCATAGAATGCGAGCACTTCGACGAGAAGATGTGC 120

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     121 AACACAACGCAGCAATGTGAAACACGGATAGAGCACTGTAAGATGGAGGCGGATAAGTTT 180

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     181 CCCAGCTGCTATGTCCTTTGGTCGGTCAACGAGACAACGGGCATCCTGCGCATCAAGATG 240

                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     241 AAGGGCTGCTTCACGGACATGCACGAATGCAATCAGACGGAGTGCGTGACCAGTGCAGAG 300

                          ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| silico     301 CCACGGCAGGG-AAACATTCACTTCTGCTGCTGCAAGGGATCGCGGTGCAATTCCAACCA 360

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     361 GAAATATATTAAAAGCACCACGGAGGCAACCACACAAGTGCCCAAGGAGAAGACGCAGGA 420

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     421 CGGCAGCAATTTGATATACATCTACATTGGCACCTCCGTTTTCAGCGTGCTCATGGTCAT 480

7904R-2.IR_full       481 TGTTGGCATGGGCCTTCTTCT 501
                          ||||||||||||||||||||| silico     481 TGTTGGCATGGGCCTTCTTCT 501

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_169591.1  CG7904-RA (put), mRNA 
0.62   37  NM_175960.3  CG33196-RB (dp), mRNA 
0.2   NM_165676.1  CG11804-RB, transcript variant B (ced-6), mRNA 
0.2   NM_136644.2  CG11804-RC, transcript variant C (ced-6), mRNA 
0.2   NM_165675.1  CG11804-RA, transcript variant A (ced-6), mRNA 
0   NM_169203.1  CG11094-RB, transcript variant B (dsx), mRNA 
0   NM_079548.4  CG11094-RC, transcript variant C (dsx), mRNA 
0   NM_135275.2  CG5958-RA (CG5958), mRNA 
0   NM_143459.1  CG1964-RA (Kul), mRNA 
0   NM_079044.1  CG17876-RA (Amy-d), mRNA 
0   NM_080421.3  CG18730-RA (Amy-p), mRNA 
0   NM_132267.4  CG12109-RB (Caf1-180), mRNA 
0   NM_079939.2  CG5580-RA, transcript variant A (sbb), mRNA 
0   NM_206161.1  CG5580-RB, transcript variant B (sbb), mRNA 
0   NM_206162.1  CG5580-RC, transcript variant C (sbb), mRNA 
0   NM_136457.2  CG1358-RA, transcript variant A (CG1358), mRNA 
0   NM_165545.1  CG1358-RB, transcript variant B (CG1358), mRNA 
0   NM_165546.1  CG1358-RC, transcript variant C (CG1358), mRNA 
0   NM_078501.2  CG5905-RA, transcript variant A (Nep1), mRNA 
0   NM_167059.1  CG5905-RB, transcript variant B (Nep1), mRNA 
0   NM_057842.2  CG16858-RA (vkg), mRNA 
0   NM_141045.1  CG7632-RA (CG7632), mRNA 
0   NM_170168.1  CG6863-RB, transcript variant B (tok), mRNA 
0   NM_057531.3  CG6863-RA, transcript variant A (tok), mRNA 
0   NM_206758.1  CG9177-RC, transcript variant C (eIF5), mRNA 
0   NM_132870.3  CG9177-RB, transcript variant B (eIF5), mRNA 
0   NM_206757.1  CG9177-RD, transcript variant D (eIF5), mRNA 
0   NM_206754.1  CG9177-RG, transcript variant G (eIF5), mRNA 
0   NM_206756.1  CG9177-RE, transcript variant E (eIF5), mRNA 
0   NM_167477.1  CG9177-RA, transcript variant A (eIF5), mRNA 
 Wing Disc
JNK signal
Caspase-3 signal
Dcompartment   Penetrance

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.