National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 7899R-2 
 Symbol Acph-1  Full Name Acid phosphatase 1 
 CG No CG7899  Old CG No CG7899 
 Synonyms CG7899, ACPH, Acph, ACP, APH, Acph-1 
 Accession No (Link to NCBI) NM_080178.4 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees male semi-lethal 
 Map Viewer
 Reference
[Please submit your publication]
Dourlen P, Fernandez-Gomez FJ, Dupont C, Grenier-Boley B, Bellenguez C, Obriot H, Caillierez R, Sottejeau Y, Chapuis J, Bretteville A, Abdelfettah F, Delay C, Malmanche N, Soininen H, Hiltunen M, Galas MC, Amouyel P, Sergeant N, Buée L, Lambert JC, Dermaut B.
Functional screening of Alzheimer risk loci identifies PTK2B as an in vivo modulator and early marker of Tau pathology.
Mol. Psychiatry (2017) 22(6) 874-883 [ PubMed ID = 27113998 ] [ RRC reference ]

Umemori M, Habara O, Iwata T, Maeda K, Nishinoue K, Okabe A, Takemura M, Takahashi K, Saigo K, Ueda R, Adachi-Yamada T.
RNAi-mediated knockdown showing impaired cell survival in Drosophila wing imaginal disc.
Gene Regul Syst Bio (2009) 3 11-20 [ PubMed ID = 19838331 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgAGCCAGCGCTGGCTCATCTTG 
 Primer Seq. 3'
aatctagaggtaccGCCTTAGCGGCCAGTATGGGA 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 AGCCAGCGCT GGCTCATCTT GATCTGCGTT ATATGTTTGC TGTCTTTTGC GCTGGCCAAT 
0061 TCGCTTCATG GCTATGCTTA TGCTGAAGGT CATCCAGTGG AGATTTCGGC CACATTGCCA 
0121 GGCCAGCTGA AGTTTGTGCA TGTCATATAT CGCCACGGCG ACAGAACGCC CGTGGATCCC 
0181 TATCCCACGG ACCCCTGGGG CGACAGGAAG TTCTGGCCCA CCGGCTGGGG AGATTTGACC 
0241 AATTTGGGCA AGCAAGAGCA CTACGACCTG GGAAAATGGC TGCGGAATCG CTATTCAAAC 
0301 CTCCTACCGC CTATATACTC CAACGAGAAC ATCTACGTTC AGTCCACCGA CGTGGATCGC 
0361 ACATTGATGA GTGCCCAGTC GAATCTGGCT GGTCTCTACG AGCCGCAAGG GGAAAGACAT 
0421 CTGGAACACG GACATCAACT GGCAACCCAT ACCCATTCAC ACCTCGCCCG AGAGNGAGNA 
0481 TCCCATACTG GCCGCTAANG N 
 in silico PCR Fragment
0001 AGCCAGCGCT GGCTCATCTT GATCTGCGTT ATATGTTTGC TGTCTTTTGC GCTGGCCAAT 
0061 TCGCTTCATG GCTATGCTAA TGCTGAAGGT CATCCAGTGG AGATTTCGGC CACATTGCCA 
0121 GGCCAGCTGA AGTTTGTGCA TGTCATATAT CGCCACGGCG ACAGAACGCC CGTGGATCCC 
0181 TATCCCACGG ACCCCTGGGG CGACAGGAAG TTCTGGCCCA CCGGCTGGGG AGATTTGACC 
0241 AATTTGGGCA AGCAAGAGCA CTACGACCTG GGAAAATGGC TGCGGAATCG CTATTCAAAC 
0301 CTCCTACCGC CTATATACTC CAACGAGAAC ATCTACGTTC AGTCCACCGA CGTGGATCGC 
0361 ACATTGATGA GTGCCCAGTC GAATCTGGCT GGTCTCTACG AGCCGCAAGG GG-AAGACAT 
0421 CTGGAACACG GACATCAACT GGCAACCCAT ACCCATTCAC ACCTCGCCCG AGAGGGAGGA 
0481 TCCCATACTG GCCGCTAAGG C 
 Assemble Data

7899R-2.IR_full       1   AGCCAGCGCTGGCTCATCTTGATCTGCGTTATATGTTTGCTGTCTTTTGCGCTGGCCAAT 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7899R-2.in silico     1   AGCCAGCGCTGGCTCATCTTGATCTGCGTTATATGTTTGCTGTCTTTTGCGCTGGCCAAT 60


7899R-2.IR_full       61  TCGCTTCATGGCTATGCTTATGCTGAAGGTCATCCAGTGGAGATTTCGGCCACATTGCCA 120
                          |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||
7899R-2.in silico     61  TCGCTTCATGGCTATGCTAATGCTGAAGGTCATCCAGTGGAGATTTCGGCCACATTGCCA 120


7899R-2.IR_full       121 GGCCAGCTGAAGTTTGTGCATGTCATATATCGCCACGGCGACAGAACGCCCGTGGATCCC 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7899R-2.in silico     121 GGCCAGCTGAAGTTTGTGCATGTCATATATCGCCACGGCGACAGAACGCCCGTGGATCCC 180


7899R-2.IR_full       181 TATCCCACGGACCCCTGGGGCGACAGGAAGTTCTGGCCCACCGGCTGGGGAGATTTGACC 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7899R-2.in silico     181 TATCCCACGGACCCCTGGGGCGACAGGAAGTTCTGGCCCACCGGCTGGGGAGATTTGACC 240


7899R-2.IR_full       241 AATTTGGGCAAGCAAGAGCACTACGACCTGGGAAAATGGCTGCGGAATCGCTATTCAAAC 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7899R-2.in silico     241 AATTTGGGCAAGCAAGAGCACTACGACCTGGGAAAATGGCTGCGGAATCGCTATTCAAAC 300


7899R-2.IR_full       301 CTCCTACCGCCTATATACTCCAACGAGAACATCTACGTTCAGTCCACCGACGTGGATCGC 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7899R-2.in silico     301 CTCCTACCGCCTATATACTCCAACGAGAACATCTACGTTCAGTCCACCGACGTGGATCGC 360


7899R-2.IR_full       361 ACATTGATGAGTGCCCAGTCGAATCTGGCTGGTCTCTACGAGCCGCAAGGGGAAAGACAT 420
                          |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||
7899R-2.in silico     361 ACATTGATGAGTGCCCAGTCGAATCTGGCTGGTCTCTACGAGCCGCAAGGGG-AAGACAT 420


7899R-2.IR_full       421 CTGGAACACGGACATCAACTGGCAACCCATACCCATTCACACCTCGCCCGAGAGNGAGNA 480
                          |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
7899R-2.in silico     421 CTGGAACACGGACATCAACTGGCAACCCATACCCATTCACACCTCGCCCGAGAGGGAGGA 480


7899R-2.IR_full       481 TCCCATACTGGCCGCTAANGN 501
                          |||||||||||||||||| | 
7899R-2.in silico     481 TCCCATACTGGCCGCTAAGGC 501

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_170453.1  CG7899-RB, transcript variant B (Acph-1), mRNA 
100   482  NM_080178.4  CG7899-RA, transcript variant A (Acph-1), mRNA 
0   NM_079164.2  CG5717-RA (yellow-g), mRNA 
0   NM_136391.2  CG9436-RA (CG9436), mRNA 
0   20  NM_175960.3  CG33196-RB (dp), mRNA 
0   NM_058007.3  CG1071-RA (E2f2), mRNA 
0   NM_166430.1  CG9441-RB, transcript variant B (Pu), mRNA 
0   NM_166431.2  CG9441-RA, transcript variant A (Pu), mRNA 
0   NM_079077.2  CG9441-RC, transcript variant C (Pu), mRNA 
0   NM_168883.1  CG32435-RC, transcript variant C (chb), mRNA 
0   NM_079912.3  CG32435-RA, transcript variant A (chb), mRNA 
0   NM_168882.2  CG32435-RB, transcript variant B (chb), mRNA 
0   NM_132189.1  CG1422-RA (p115), mRNA 
0   NM_169214.1  CG31464-RA (CG31464), mRNA 
0   NM_140861.1  CG9451-RA (CG9451), mRNA 
0   NM_143092.2  CG10244-RA (Cad96Ca), mRNA 
0   NM_078670.2  CG7092-RA (Dhc16F), mRNA 
0   NM_170450.1  CG31036-RA (CG31036), mRNA 
0   NM_165099.1  CG7595-RA, transcript variant A (ck), mRNA 
0   NM_078847.2  CG7595-RB, transcript variant B (ck), mRNA 
0   NM_001032080.1  CG33695-RA, transcript variant A (CG33695), mRNA 
0   NM_001032076.1  CG33694-RA, transcript variant A (cana), mRNA 
0   NM_080254.2  CG6392-RA (cmet), mRNA 
0   NM_140011.2  CG5660-RA (CG5660), mRNA 
0   NM_167494.1  CG9911-RB, transcript variant B (CG9911), mRNA 
0   NM_167496.1  CG9911-RC, transcript variant C (CG9911), mRNA 
0   NM_132883.2  CG9911-RA, transcript variant A (CG9911), mRNA 
0   NM_166883.1  CG32813-RF, transcript variant F (CG32813), mRNA 
0   NM_130553.2  CG32813-RA, transcript variant A (CG32813), mRNA 
0   NM_166882.1  CG32813-RC, transcript variant C (CG32813), mRNA 
 Wing Disc
GFP
Puc
Caspase
DAPI
Merge
Figure
JNK signal
N
 
DB
 
DC
 
DM
 
VM
 
VB
 
Caspase-3 signal
N
DB
DC
++ 
DM
 
VM
 
VB
 
Dcompartment   Penetrance
     

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.