National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 7890R-2 
 Symbol Hs3st-B  Full Name Heparan sulfate 3-O sulfotransferase-B 
 CG No CG7890  Old CG No CG7890 
 Synonyms Hs3st-B, CG7890, dHs3st-B 
 Accession No (Link to NCBI)  
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
Ueyama M, Takemae H, Ohmae Y, Yoshida H, Toyoda H, Ueda R, Nishihara S.
Functional analysis of proteoglycan galactosyltransferase II RNA interference mutant flies.
J. Biol. Chem. (2008) 283(10) 6076-84 [ PubMed ID = 18165227 ] [ RRC reference ]

Goda E, Kamiyama S, Uno T, Yoshida H, Ueyama M, Kinoshita-Toyoda A, Toyoda H, Ueda R, Nishihara S.
Identification and characterization of a novel Drosophila 3'-phosphoadenosine 5'-phosphosulfate transporter.
J. Biol. Chem. (2006) 281(39) 28508-17 [ PubMed ID = 16873373 ] [ RRC reference ]

Yamamoto-Hino M, Yoshida H, Ichimiya T, Sakamura S, Maeda M, Kimura Y, Sasaki N, Aoki-Kinoshita KF, Kinoshita-Toyoda A, Toyoda H, Ueda R, Nishihara S, Goto S.
Phenotype-based clustering of glycosylation-related genes by RNAi-mediated gene silencing.
Genes Cells (2015) 20(6) 521-42 [ PubMed ID = 25940448 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgATCACCATGGAGAAGACGCCC 
 Primer Seq. 3'
aatctagaggtaccGGATCTATGTGCGGATGGTTG 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 GATCACCATG GAGAAGACGC CCAGCTACTT CGTCACCAAG GAGGTGCCGC AGCGCGTCTA 
0061 CCACATGAAT CCGGCAACAA AATTACTGAT TGTGGTGCGG GATCCGGTGA CGCGGGCCAT 
0121 CTCCGACTAC ACACAGGCGG CGAGCAAGAA GGCGGACATG AAGCTCTTCG AGCAGCTGGC 
0181 CTTCGTCAAC GGTAGCTACT CGGTGGTGGA CACCAACTGG GGCCCGGTGA AGATCGGCGT 
0241 CTATGCACGC TATCTGGAGC GCTGGCTGCT CTACTTTCCG CTCTCGCAGC TGCTCTTCAT 
0301 CAGCGGCGAG CGNCTGATCA TGGATCCCGC CTACGAGATT GGACGCGTAC AGGACTTCCT 
0361 CGGTCTGAAG CGCGTGGTCA CCGAGAAGCA CTTCTACTTC AATGCCACCA AGGGCTTCCC 
0421 CTGCCTCTTC AAGTCGGAGG CACGCTCCAC GCCCCACTGT CTGGGTAAGA CCAAGNGGCG 
0481 CAACCATCCG CACATAGATC C 
 in silico PCR Fragment
0001 atcaccatgg agaagacgcc cagctacttc gtcaccaagg aggtgccgca gcgcgtctac 
0061 cacatgaatc cggcaacaaa attactgatt gtggtgcggg atccggtgac gcgggccatc 
0121 tccgactaca cacaggcggc gagcaagaag gcggacatga agctcttcga gcagctggcc 
0181 ttcgtcaacg gtagctactc ggtggtggac accaactggg gcccggtgaa gatcggcgtc 
0241 tatgcacgct atctggagcg ctggctgctc tactttccgc tctcgcagct gctcttcatc 
0301 agcggcgagc ggctgatcat ggatcccgcc tacgagattg gacgcgtaca ggacttcctc 
0361 ggtctgaagc gcgtggtcac cgagaagcac ttctacttca atgccaccaa gggcttcccc 
0421 tgcctcttca agtcggaggc acgctccacg ccccactgtc tgggtaagac caaggggcgc 
0481 aaccatccgc acatagatcc  
 Assemble Data

7890R-2.IR full       1   GATCACCATGGAGAAGACGCCCAGCTACTTCGTCACCAAGGAGGTGCCGCAGCGCGTCTA 60
                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7890R-2.in silico     1   -ATCACCATGGAGAAGACGCCCAGCTACTTCGTCACCAAGGAGGTGCCGCAGCGCGTCTA 60


7890R-2.IR full       61  CCACATGAATCCGGCAACAAAATTACTGATTGTGGTGCGGGATCCGGTGACGCGGGCCAT 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7890R-2.in silico     61  CCACATGAATCCGGCAACAAAATTACTGATTGTGGTGCGGGATCCGGTGACGCGGGCCAT 120


7890R-2.IR full       121 CTCCGACTACACACAGGCGGCGAGCAAGAAGGCGGACATGAAGCTCTTCGAGCAGCTGGC 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7890R-2.in silico     121 CTCCGACTACACACAGGCGGCGAGCAAGAAGGCGGACATGAAGCTCTTCGAGCAGCTGGC 180


7890R-2.IR full       181 CTTCGTCAACGGTAGCTACTCGGTGGTGGACACCAACTGGGGCCCGGTGAAGATCGGCGT 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7890R-2.in silico     181 CTTCGTCAACGGTAGCTACTCGGTGGTGGACACCAACTGGGGCCCGGTGAAGATCGGCGT 240


7890R-2.IR full       241 CTATGCACGCTATCTGGAGCGCTGGCTGCTCTACTTTCCGCTCTCGCAGCTGCTCTTCAT 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7890R-2.in silico     241 CTATGCACGCTATCTGGAGCGCTGGCTGCTCTACTTTCCGCTCTCGCAGCTGCTCTTCAT 300


7890R-2.IR full       301 CAGCGGCGAGCGNCTGATCATGGATCCCGCCTACGAGATTGGACGCGTACAGGACTTCCT 360
                          |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||
7890R-2.in silico     301 CAGCGGCGAGCGGCTGATCATGGATCCCGCCTACGAGATTGGACGCGTACAGGACTTCCT 360


7890R-2.IR full       361 CGGTCTGAAGCGCGTGGTCACCGAGAAGCACTTCTACTTCAATGCCACCAAGGGCTTCCC 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7890R-2.in silico     361 CGGTCTGAAGCGCGTGGTCACCGAGAAGCACTTCTACTTCAATGCCACCAAGGGCTTCCC 420


7890R-2.IR full       421 CTGCCTCTTCAAGTCGGAGGCACGCTCCACGCCCCACTGTCTGGGTAAGACCAAGNGGCG 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||
7890R-2.in silico     421 CTGCCTCTTCAAGTCGGAGGCACGCTCCACGCCCCACTGTCTGGGTAAGACCAAGGGGCG 480


7890R-2.IR full       481 CAACCATCCGCACATAGATCC 501
                          |||||||||||||||||||||
7890R-2.in silico     481 CAACCATCCGCACATAGATCC 501

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100  482  NM_133142.1  CG7890-RA (CG7890), mRNA 
0.62  NM_168288.1  CG32029-RA (CG32029), mRNA 
0.2  NM_176325.1  Ral guanine nucleotide exchange factor 2 CG8865-RB, transcript variant B (Rgl), mRNA 
0.2  NM_176327.1  Ral guanine nucleotide exchange factor 2 CG8865-RD, transcript variant D (Rgl), mRNA 
0.2  NM_176326.1  Ral guanine nucleotide exchange factor 2 CG8865-RC, transcript variant C (Rgl), mRNA 
0.2  NM_079958.2  Ral guanine nucleotide exchange factor 2 CG8865-RA, transcript variant A (Rgl), mRNA 
NM_167244.1  Transport and Golgi organization 5 CG32675-RB, transcript variant B (Tango5), mRNA 
NM_167242.1  Transport and Golgi organization 5 CG32675-RA, transcript variant A (Tango5), mRNA 
NM_167243.1  Transport and Golgi organization 5 CG32675-RC, transcript variant C (Tango5), mRNA 
NM_166535.1  plexus CG4444-RA (px), mRNA 
NM_080048.2  Lobe CG10109-RA (L), mRNA 
NM_167085.1  CG3168-RB, transcript variant B (CG3168), mRNA 
NM_132117.1  CG3168-RA, transcript variant A (CG3168), mRNA 
NM_167086.1  CG3168-RC, transcript variant C (CG3168), mRNA 
NM_141591.1  CG11966-RA (CG11966), mRNA 
NM_079427.2  UDP-glucose-glycoprotein glucosyltransferase CG6850-RA (Ugt), mRNA 
NM_132991.1  CG12432-RA (CG12432), mRNA 
NM_136527.1  CG14755-RA (CG14755), mRNA 
NM_137051.1  CG13337-RA (CG13337), mRNA 
NM_137621.2  CG10444-RA (CG10444), mRNA 
NM_137992.1  CG5549-RA (CG5549), mRNA 
NM_168367.1  CG32046-RA, transcript variant A (CG32046), mRNA 
NM_168366.2  CG32046-RB, transcript variant B (CG32046), mRNA 
NM_001043104.1  ion transport peptide CG13586-RB, transcript variant B (itp), mRNA 
NM_138087.3  ion transport peptide CG13586-RA, transcript variant A (itp), mRNA 
NM_135409.1  CG9468-RA (CG9468), mRNA 
NM_143096.2  CG11851-RA (CG11851), mRNA 
NM_142088.2  CG9631-RA (CG9631), mRNA 
17  31  NM_176229.1  CG33147-RA (CG33147), mRNA 
NM_143262.1  CG14254-RA (CG14254), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.