National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 7890R-1 
 Symbol Hs3st-B  Full Name Heparan sulfate 3-O sulfotransferase-B 
 CG No CG7890  Old CG No CG7890 
 Synonyms Hs3st-B, CG7890, dHs3st-B 
 Accession No (Link to NCBI)  
 Inserted Chr.
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
Ueyama M, Takemae H, Ohmae Y, Yoshida H, Toyoda H, Ueda R, Nishihara S.
Functional analysis of proteoglycan galactosyltransferase II RNA interference mutant flies.
J. Biol. Chem. (2008) 283(10) 6076-84 [ PubMed ID = 18165227 ] [ RRC reference ]

Goda E, Kamiyama S, Uno T, Yoshida H, Ueyama M, Kinoshita-Toyoda A, Toyoda H, Ueda R, Nishihara S.
Identification and characterization of a novel Drosophila 3'-phosphoadenosine 5'-phosphosulfate transporter.
J. Biol. Chem. (2006) 281(39) 28508-17 [ PubMed ID = 16873373 ] [ RRC reference ]

Yamamoto-Hino M, Yoshida H, Ichimiya T, Sakamura S, Maeda M, Kimura Y, Sasaki N, Aoki-Kinoshita KF, Kinoshita-Toyoda A, Toyoda H, Ueda R, Nishihara S, Goto S.
Phenotype-based clustering of glycosylation-related genes by RNAi-mediated gene silencing.
Genes Cells (2015) 20(6) 521-42 [ PubMed ID = 25940448 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgATCACCATGGAGAAGACGCCC 
 Primer Seq. 3'
aatctagaggtaccGGATCTATGTGCGGATGGTTG 
 Predicted Fragment Size
500 
 IR fragment full Seq
 
 in silico PCR Fragment
 
 Assemble Data

7890R-1.IR full       1   GATCACCATGGAGAAGACGCCCAGCTACTTCGTCACCAAGGAGGTGCCGCAGCGCGTCTA 60
                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7890R-1.in silico     1   -ATCACCATGGAGAAGACGCCCAGCTACTTCGTCACCAAGGAGGTGCCGCAGCGCGTCTA 60


7890R-1.IR full       61  CCACATGAATCCGGCAACAAAATTACTGATTGTGGTGCGGGATCCGGTGACGCGGGCCAT 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7890R-1.in silico     61  CCACATGAATCCGGCAACAAAATTACTGATTGTGGTGCGGGATCCGGTGACGCGGGCCAT 120


7890R-1.IR full       121 CTCCGACTACACACAGGCGGCGAGCAAGAAGGCGGACATGAAGCTCTTCGAGCAGCTGGC 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7890R-1.in silico     121 CTCCGACTACACACAGGCGGCGAGCAAGAAGGCGGACATGAAGCTCTTCGAGCAGCTGGC 180


7890R-1.IR full       181 CTTCGTCAACGGTAGCTACTCGGTGGTGGACACCAACTGGGGCCCGGTGAAGATCGGCGT 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7890R-1.in silico     181 CTTCGTCAACGGTAGCTACTCGGTGGTGGACACCAACTGGGGCCCGGTGAAGATCGGCGT 240


7890R-1.IR full       241 CTATGCACGCTATCTGGAGCGCTGGCTGCTCTACTTTCCGCTCTCGCAGCTGCTCTTCAT 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7890R-1.in silico     241 CTATGCACGCTATCTGGAGCGCTGGCTGCTCTACTTTCCGCTCTCGCAGCTGCTCTTCAT 300


7890R-1.IR full       301 CAGCGGCGAGCGNCTGATCATGGATCCCGCCTACGAGATTGGACGCGTACAGGACTTCCT 360
                          |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||
7890R-1.in silico     301 CAGCGGCGAGCGGCTGATCATGGATCCCGCCTACGAGATTGGACGCGTACAGGACTTCCT 360


7890R-1.IR full       361 CGGTCTGAAGCGCGTGGTCACCGAGAAGCACTTCTACTTCAATGCCACCAAGGGCTTCCC 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7890R-1.in silico     361 CGGTCTGAAGCGCGTGGTCACCGAGAAGCACTTCTACTTCAATGCCACCAAGGGCTTCCC 420


7890R-1.IR full       421 CTGCCTCTTCAAGTCGGAGGCACGCTCCACGCCCCACTGTCTGGGTAAGACCAAGNGGCG 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||
7890R-1.in silico     421 CTGCCTCTTCAAGTCGGAGGCACGCTCCACGCCCCACTGTCTGGGTAAGACCAAGGGGCG 480


7890R-1.IR full       481 CAACCATCCGCACATAGATCC 501
                          |||||||||||||||||||||
7890R-1.in silico     481 CAACCATCCGCACATAGATCC 501

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100  482  NM_133142.1  CG7890-RA (CG7890), mRNA 
0.62  NM_168288.1  CG32029-RA (CG32029), mRNA 
0.2  NM_176325.1  Ral guanine nucleotide exchange factor 2 CG8865-RB, transcript variant B (Rgl), mRNA 
0.2  NM_176327.1  Ral guanine nucleotide exchange factor 2 CG8865-RD, transcript variant D (Rgl), mRNA 
0.2  NM_176326.1  Ral guanine nucleotide exchange factor 2 CG8865-RC, transcript variant C (Rgl), mRNA 
0.2  NM_079958.2  Ral guanine nucleotide exchange factor 2 CG8865-RA, transcript variant A (Rgl), mRNA 
NM_167244.1  Transport and Golgi organization 5 CG32675-RB, transcript variant B (Tango5), mRNA 
NM_167242.1  Transport and Golgi organization 5 CG32675-RA, transcript variant A (Tango5), mRNA 
NM_167243.1  Transport and Golgi organization 5 CG32675-RC, transcript variant C (Tango5), mRNA 
NM_166535.1  plexus CG4444-RA (px), mRNA 
NM_080048.2  Lobe CG10109-RA (L), mRNA 
NM_167085.1  CG3168-RB, transcript variant B (CG3168), mRNA 
NM_132117.1  CG3168-RA, transcript variant A (CG3168), mRNA 
NM_167086.1  CG3168-RC, transcript variant C (CG3168), mRNA 
NM_141591.1  CG11966-RA (CG11966), mRNA 
NM_079427.2  UDP-glucose-glycoprotein glucosyltransferase CG6850-RA (Ugt), mRNA 
NM_132991.1  CG12432-RA (CG12432), mRNA 
NM_136527.1  CG14755-RA (CG14755), mRNA 
NM_137051.1  CG13337-RA (CG13337), mRNA 
NM_137621.2  CG10444-RA (CG10444), mRNA 
NM_137992.1  CG5549-RA (CG5549), mRNA 
NM_168367.1  CG32046-RA, transcript variant A (CG32046), mRNA 
NM_168366.2  CG32046-RB, transcript variant B (CG32046), mRNA 
NM_001043104.1  ion transport peptide CG13586-RB, transcript variant B (itp), mRNA 
NM_138087.3  ion transport peptide CG13586-RA, transcript variant A (itp), mRNA 
NM_135409.1  CG9468-RA (CG9468), mRNA 
NM_143096.2  CG11851-RA (CG11851), mRNA 
NM_142088.2  CG9631-RA (CG9631), mRNA 
17  31  NM_176229.1  CG33147-RA (CG33147), mRNA 
NM_143262.1  CG14254-RA (CG14254), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.