National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 7873R-3 
 Symbol Src42A  Full Name Src oncogene at 42A 
 CG No CG7873  Old CG No CG7873 
 Synonyms src42A, Src42, DSrc42A, Src, src42, Dsrc42A, SRC 42A, CG7873, SK2-4, src, Dsrc41, dtk5, DmHD-29, Src41, Su(Raf)1, Su1, Dm SRC41, dtk-5, Su(phl)1, Su(D-raf)1, SRC42A, l(2)k10108, Tk5, HD-29, Dtk5, Src42A 
 Accession No (Link to NCBI) NM_057501.3 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Houtz P, Bonfini A, Liu X, Revah J, Guillou A, Poidevin M, Hens K, Huang HY, Deplancke B, Tsai YC, Buchon N.
Hippo, TGF-β, and Src-MAPK pathways regulate transcription of the upd3 cytokine in Drosophila enterocytes upon bacterial infection.
PLoS Genet. (2017) 13(11) e1007091 [ PubMed ID = 29108021 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgACACAGAAGGGCGAACCCGAC 
 Primer Seq. 3'
aatctagaggtaccCCATCGCGCACTGATAGCGAG 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 ACACAGAAGG GCGAACCCGA CAAGCCCGCA GATCGAATCA AGCTGGACGA CCCGCCCACC 
0061 ATCGGAGTCG GAGTGGGCGT GCCACAAATC CCCATGCCCT CACACGCCGG ACAGCCACCG 
0121 GAGCAGATAC GTCCGGTTCC CCAGATCCCG GAGAGCGAAA CGGCAGGTGC CAACGCCAAG 
0181 ATTTTTGTCG CCCTCTACGA CTACGACGCC CGCACCGACG AGGATTTGAG CTTCCGCAAG 
0241 GGAGAGCACT TGGAGATACT GAATGACACG CAGGGTGACT GGTGGCTGGC GCGGAGCAAG 
0301 AAGACACGTT CGGAAGGCTA CATTCCATCC AATTATGTGG CCAAGTTGAA ATCAATCGAA 
0361 GCAGAACCCT GGTACTTCCG CAAAATCAAA CGCATTGAGG CTGAGAAAAA ACTTCTACTG 
0421 CCAGAGAACG AGCACGGTGC ATTTTTAATT CGCGATTCCG AAAGCCGTCA CAACGACTAC 
0481 TCGCTATCAG TGCGCGATGG  
 in silico PCR Fragment
0001 ACACAGAAGG GCGAACCCGA CAAGCCCGCA GATCGAATCA AGCTGGACGA CCCGCCCACC 
0061 ATCGGAGTCG GAGTGGGCGT GCCACAAATC CCCATGCCCT CACACGCCGG ACAGCCACCG 
0121 GAGCAGATAC GTCCGGTTCC CCAGATCCCG GAGAGCGAAA CGGCAGGTGC CAACGCCAAG 
0181 ATTTTTGTCG CCCTCTACGA CTACGACGCC CGCACCGACG AGGATTTGAG CTTCCGCAAG 
0241 GGAGAGCACT TGGAGATACT GAATGACACG CAGGGTGACT GGTGGCTGGC GCGGAGCAAG 
0301 AAGACACGTT CGGAAGGCTA CATTCCATCC AATTATGTGG CCAAGTTGAA ATCAATCGAA 
0361 GCAGAACCCT GGTACTTCCG CAAAATCAAA CGCATTGAGG CTGAGAAAAA ACTTCTACTG 
0421 CCAGAGAACG AGCACGGTGC ATTTTTAATT CGCGATTCCG AAAGCCGTCA CAACGACTAC 
0481 TCGCTATCAG TGCGCGATGG  
 Assemble Data

7873R-3.IR_full       1   ACACAGAAGGGCGAACCCGACAAGCCCGCAGATCGAATCAAGCTGGACGACCCGCCCACC 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7873R-3.in silico     1   ACACAGAAGGGCGAACCCGACAAGCCCGCAGATCGAATCAAGCTGGACGACCCGCCCACC 60


7873R-3.IR_full       61  ATCGGAGTCGGAGTGGGCGTGCCACAAATCCCCATGCCCTCACACGCCGGACAGCCACCG 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7873R-3.in silico     61  ATCGGAGTCGGAGTGGGCGTGCCACAAATCCCCATGCCCTCACACGCCGGACAGCCACCG 120


7873R-3.IR_full       121 GAGCAGATACGTCCGGTTCCCCAGATCCCGGAGAGCGAAACGGCAGGTGCCAACGCCAAG 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7873R-3.in silico     121 GAGCAGATACGTCCGGTTCCCCAGATCCCGGAGAGCGAAACGGCAGGTGCCAACGCCAAG 180


7873R-3.IR_full       181 ATTTTTGTCGCCCTCTACGACTACGACGCCCGCACCGACGAGGATTTGAGCTTCCGCAAG 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7873R-3.in silico     181 ATTTTTGTCGCCCTCTACGACTACGACGCCCGCACCGACGAGGATTTGAGCTTCCGCAAG 240


7873R-3.IR_full       241 GGAGAGCACTTGGAGATACTGAATGACACGCAGGGTGACTGGTGGCTGGCGCGGAGCAAG 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7873R-3.in silico     241 GGAGAGCACTTGGAGATACTGAATGACACGCAGGGTGACTGGTGGCTGGCGCGGAGCAAG 300


7873R-3.IR_full       301 AAGACACGTTCGGAAGGCTACATTCCATCCAATTATGTGGCCAAGTTGAAATCAATCGAA 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7873R-3.in silico     301 AAGACACGTTCGGAAGGCTACATTCCATCCAATTATGTGGCCAAGTTGAAATCAATCGAA 360


7873R-3.IR_full       361 GCAGAACCCTGGTACTTCCGCAAAATCAAACGCATTGAGGCTGAGAAAAAACTTCTACTG 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7873R-3.in silico     361 GCAGAACCCTGGTACTTCCGCAAAATCAAACGCATTGAGGCTGAGAAAAAACTTCTACTG 420


7873R-3.IR_full       421 CCAGAGAACGAGCACGGTGCATTTTTAATTCGCGATTCCGAAAGCCGTCACAACGACTAC 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7873R-3.in silico     421 CCAGAGAACGAGCACGGTGCATTTTTAATTCGCGATTCCGAAAGCCGTCACAACGACTAC 480


7873R-3.IR_full       481 TCGCTATCAGTGCGCGATGG 500
                          ||||||||||||||||||||
7873R-3.in silico     481 TCGCTATCAGTGCGCGATGG 500

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_165452.1  CG7873-RB, transcript variant B (Src42A), mRNA 
100   482  NM_057501.3  CG7873-RA, transcript variant A (Src42A), mRNA 
0   NM_138988.2  CG11405-RA (A3-3), mRNA 
0   NM_169658.2  CG5166-RC, transcript variant C (Atx2), mRNA 
0   NM_142209.2  CG5166-RA, transcript variant A (Atx2), mRNA 
0   NM_169657.1  CG5166-RB, transcript variant B (Atx2), mRNA 
0   NM_138049.2  CG3328-RA (CG3328), mRNA 
0   NM_164716.1  CG31632-RA (CG31632), mRNA 
0   NM_169653.2  CG31302-RB, transcript variant B (CG31302), mRNA 
0   NM_169652.2  CG31302-RA, transcript variant A (CG31302), mRNA 
0   NM_169654.2  CG31302-RC, transcript variant C (CG31302), mRNA 
0   NM_078945.2  CG2346-RA (Fmrf), mRNA 
0   NM_078597.2  CG15871-RA (mRpL38), mRNA 
0   NM_137690.2  CG10543-RA, transcript variant A (CG10543), mRNA 
0   NM_166416.1  CG10543-RB, transcript variant B (CG10543), mRNA 
0   NM_176241.1  CG10543-RC, transcript variant C (CG10543), mRNA 
0   38  129  NM_166125.2  CG18255-RA, transcript variant A (Strn-Mlck), mRNA 
0   38  127  NM_166129.2  CG18255-RD, transcript variant D (Strn-Mlck), mRNA 
0   15  NM_079903.2  CG15319-RB (nej), mRNA 
0   NM_140033.1  CG4684-RA (nwk), mRNA 
0   NM_168725.2  CG13731-RA (CG13731), mRNA 
0   NM_001043126.1  CG34158-RD, transcript variant D (SP2523), mRNA 
0   NM_001043125.1  CG34158-RC, transcript variant C (SP2523), mRNA 
0   NM_176233.2  CG15102-RB, transcript variant B (Jheh2), mRNA 
0   NM_137542.2  CG15102-RA, transcript variant A (Jheh2), mRNA 
0   NM_079181.2  CG1065-RA (Scsalpha), mRNA 
0   11  NM_168156.1  CG7018-RA, transcript variant A (Ets65A), mRNA 
0   NM_079336.2  CG7002-RA (Hml), mRNA 
0   NM_079221.2  CG7018-RB, transcript variant B (Ets65A), mRNA 
0   NM_001014624.1  CG33555-RC, transcript variant C (btsz), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.