National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 7855R-1 
 Symbol timeout  Full Name timeout 
 CG No CG7855  Old CG No CG7855 
 Synonyms tim2, dtim2, TIM2, CG8148, CG14382, CG14381, CG7855, timeout 
 Accession No (Link to NCBI) NM_079617.3 
 Inserted Chr. ll 
 Insertional Mutation  lethal 
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Lindström R, Lindholm P, Palgi M, Saarma M, Heino TI.
In vivo screening reveals interactions between Drosophila Manf and genes involved in the mitochondria and the ubiquinone synthesis pathway.
BMC Genet (2017) 18(1) 52 [ PubMed ID = 28578657 ] [ RRC reference ]

Umemori M, Habara O, Iwata T, Maeda K, Nishinoue K, Okabe A, Takemura M, Takahashi K, Saigo K, Ueda R, Adachi-Yamada T.
RNAi-mediated knockdown showing impaired cell survival in Drosophila wing imaginal disc.
Gene Regul Syst Bio (2009) 3 11-20 [ PubMed ID = 19838331 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgCTATTCTGCTGGCGGACATTG 
 Primer Seq. 3'
aatctagaggtaccCACTTGCAGAACGTTCCGCAC 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 CTATTCTGCT GGCGGACATT GATGCCACGT GTGCGGCCTT GGGATACAGT GATGGACAGA 
0061 AATATCAAGC GGAGCCTGAT GCCGCCGAGG GTCTCAAGCA TCTGATATGG ATTCTGCGTC 
0121 GGGACCTGGA CAACCACGAG TATCGCCGTC ATTTGGGCCG CTCCAAGGTG CTCCAAACGG 
0181 ACTTGGTTTA CATGCTGCCG GACTATGTGC ATCACGAGGA GCTATCCGAT CTACTGATCC 
0241 GCCTGCTGGT CATCCTGACC AATCCGACAC TGCTGCTCTA CCGGGAGGGT GCTCCCAAGG 
0301 ACAACCATGG CCGGAAAGTG TTCATGGAGC TAATCGACAT CCTGCAGGGC TACAAAGCAG 
0361 CCTTTGCCAA GGACAAAGTC TGGAGCGCCC TTTTCGAGAA GCTCAAGCAG GCTTTGGAAA 
0421 TAGCATTTGC GATTCGCAGC GAAGAGCAGA ATCTTCTGAT TGAGCGCATC CTGGTCCTGG 
0481 TGCGGAACGT TCTGCAAGTN G 
 in silico PCR Fragment
0001 CTATTCTGCT GGCGGACATT GATGCCACGT GTGCGGCCTT GGGATACAGT GATGGACAGA 
0061 AATATCAAGC GGAGCCTGAT GCCGCCGAGG GTCTCAAGCA TCTGATATGG ATTCTGCGTC 
0121 GGGACCTGGA CAACCACGAG TATCGCCGTC ATTTGGGCCG CTCCAAGGTG CTCCAAACGG 
0181 ACTTGGTTTA CATGCTGCCG GACTATGTGC ATCACGAGGA GCTATCCGAT CTACTGATCC 
0241 GCCTGCTGGT CATCCTGACC AATCCGACAC TGCTGCTCTA CCGGGAGGGT GCTCCCAAGG 
0301 ACAACCATGG CCGGAAAGTG TTCATGGAGC TAATCGACAT CCTGCAGGGC TACAAAGCAG 
0361 CCTTTGCCAA GGACAAAGTC TGGAGCGCCC TTTTCGAGAA GCTCAAGCAG GCTTTGGAAA 
0421 TAGCATTTGC GATTCGCAGC GAAGAGCAGA ATCTTCTGAT TGAGCGCATC CTGGTCCTGG 
0481 TGCGGAACGT TCTGCAAGT- G 
 Assemble Data

7855R-1.IR_full       1   CTATTCTGCTGGCGGACATTGATGCCACGTGTGCGGCCTTGGGATACAGTGATGGACAGA 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7855R-1.in silico     1   CTATTCTGCTGGCGGACATTGATGCCACGTGTGCGGCCTTGGGATACAGTGATGGACAGA 60


7855R-1.IR_full       61  AATATCAAGCGGAGCCTGATGCCGCCGAGGGTCTCAAGCATCTGATATGGATTCTGCGTC 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7855R-1.in silico     61  AATATCAAGCGGAGCCTGATGCCGCCGAGGGTCTCAAGCATCTGATATGGATTCTGCGTC 120


7855R-1.IR_full       121 GGGACCTGGACAACCACGAGTATCGCCGTCATTTGGGCCGCTCCAAGGTGCTCCAAACGG 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7855R-1.in silico     121 GGGACCTGGACAACCACGAGTATCGCCGTCATTTGGGCCGCTCCAAGGTGCTCCAAACGG 180


7855R-1.IR_full       181 ACTTGGTTTACATGCTGCCGGACTATGTGCATCACGAGGAGCTATCCGATCTACTGATCC 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7855R-1.in silico     181 ACTTGGTTTACATGCTGCCGGACTATGTGCATCACGAGGAGCTATCCGATCTACTGATCC 240


7855R-1.IR_full       241 GCCTGCTGGTCATCCTGACCAATCCGACACTGCTGCTCTACCGGGAGGGTGCTCCCAAGG 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7855R-1.in silico     241 GCCTGCTGGTCATCCTGACCAATCCGACACTGCTGCTCTACCGGGAGGGTGCTCCCAAGG 300


7855R-1.IR_full       301 ACAACCATGGCCGGAAAGTGTTCATGGAGCTAATCGACATCCTGCAGGGCTACAAAGCAG 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7855R-1.in silico     301 ACAACCATGGCCGGAAAGTGTTCATGGAGCTAATCGACATCCTGCAGGGCTACAAAGCAG 360


7855R-1.IR_full       361 CCTTTGCCAAGGACAAAGTCTGGAGCGCCCTTTTCGAGAAGCTCAAGCAGGCTTTGGAAA 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7855R-1.in silico     361 CCTTTGCCAAGGACAAAGTCTGGAGCGCCCTTTTCGAGAAGCTCAAGCAGGCTTTGGAAA 420


7855R-1.IR_full       421 TAGCATTTGCGATTCGCAGCGAAGAGCAGAATCTTCTGATTGAGCGCATCCTGGTCCTGG 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7855R-1.in silico     421 TAGCATTTGCGATTCGCAGCGAAGAGCAGAATCTTCTGATTGAGCGCATCCTGGTCCTGG 480


7855R-1.IR_full       481 TGCGGAACGTTCTGCAAGTNG 501
                          ||||||||||||||||||| |
7855R-1.in silico     481 TGCGGAACGTTCTGCAAGT-G 501

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_079617.3  CG7855-RA (timeout), mRNA 
0   NM_079659.2  CG3937-RA, transcript variant A (cher), mRNA 
0   NM_206502.1  CG3937-RD, transcript variant D (cher), mRNA 
0   NM_132953.1  CG13001-RA (CG13001), mRNA 
0   NM_078696.2  CG1467-RA (Syx16), mRNA 
0   NM_139511.2  CG1869-RA (CG1869), mRNA 
0   NM_137151.2  CG10212-RA (SMC2), mRNA 
0   NM_144017.1  CG18682-RA (CG18682), mRNA 
0   NM_141775.1  CG14695-RA (CG14695), mRNA 
0   NM_134742.2  CG5001-RA (CG5001), mRNA 
0   NM_135238.2  CG10354-RA (CG10354), mRNA 
0   NM_134676.1  CG4213-RA (CG4213), mRNA 
0   NM_079751.3  CG31136-RA (Syx1A), mRNA 
0   NM_142976.2  CG13609-RA (CG13609), mRNA 
0   NM_137628.1  CG13868-RA (CG13868), mRNA 
0   NM_001042886.1  CG34109-RB (CG34109), mRNA 
0   NM_141835.2  CG14710-RA (CG14710), mRNA 
0   NM_167296.1  CG1830-RB, transcript variant B (PhKgamma), mRNA 
0   NM_078574.2  CG1830-RA, transcript variant A (PhKgamma), mRNA 
0   NM_167297.1  CG1830-RC, transcript variant C (PhKgamma), mRNA 
0   NM_140008.1  CG5741-RA (CG5741), mRNA 
0   NM_136135.2  CG10132-RA (CG10132), mRNA 
0   NM_141238.1  CG17387-RA (CG17387), mRNA 
0   NM_142363.4  CG5407-RB, transcript variant B (Sur-8), mRNA 
0   NM_169758.1  CG5407-RA, transcript variant A (Sur-8), mRNA 
0   NM_164764.1  CG7052-RD, transcript variant D (TepII), mRNA 
0   NM_143431.1  CG11951-RA (CG11951), mRNA 
0   NM_139645.2  CG15021-RA (CG15021), mRNA 
0   NM_164763.1  CG7052-RE, transcript variant E (TepII), mRNA 
0   NM_164762.1  CG7052-RC, transcript variant C (TepII), mRNA 
 Wing Disc
GFP
Puc
Caspase
DAPI
Merge
Figure
JNK signal
N
 
DB
 
DC
DM
 
VM
 
VB
 
Caspase-3 signal
N
++ 
DB
DC
++ 
DM
VM
VB
 
Dcompartment   Penetrance
   

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.