National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 7853R-2 
 Symbol Papst2  Full Name CG7853 
 CG No CG7853  Old CG No CG7853 
 Synonyms Papst2, CG7853, dPAPST2 
 Accession No (Link to NCBI)  
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees pharate adult pupal lehal 
 Map Viewer
 Reference
[Please submit your publication]
Goda E, Kamiyama S, Uno T, Yoshida H, Ueyama M, Kinoshita-Toyoda A, Toyoda H, Ueda R, Nishihara S.
Identification and characterization of a novel Drosophila 3'-phosphoadenosine 5'-phosphosulfate transporter.
J. Biol. Chem. (2006) 281(39) 28508-17 [ PubMed ID = 16873373 ] [ RRC reference ]

Yamamoto-Hino M, Yoshida H, Ichimiya T, Sakamura S, Maeda M, Kimura Y, Sasaki N, Aoki-Kinoshita KF, Kinoshita-Toyoda A, Toyoda H, Ueda R, Nishihara S, Goto S.
Phenotype-based clustering of glycosylation-related genes by RNAi-mediated gene silencing.
Genes Cells (2015) 20(6) 521-42 [ PubMed ID = 25940448 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgCCATGGGTCTGTCCAACTCAA 
 Primer Seq. 3'
aatctagaggtaccACCACTACTCCTCACCAGAGC 
 Predicted Fragment Size
500 
 IR fragment full Seq
 
 in silico PCR Fragment
 
 Assemble Data

7853R-2.IR full       1   CCATGGGTCTGTCCAACTCAAGTCTCGGCTACCTGAACTATCCCACCCAGGTGATTTTCA 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7853R-2.in silico     1   CCATGGGTCTGTCCAACTCAAGTCTCGGCTACCTGAACTATCCCACCCAGGTGATTTTCA 60


7853R-2.IR full       61  AGTGCTGCAA-CTCATTCCCGTGCTGGTGGGCAGCATCCTCATACAGGGCAAACGCTACG 120
                          |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||
7853R-2.in silico     61  AGTGCTGCAAGCTCATTCCCGTGCTGGTGGGCAGCATCCTCATACAGGGCAAACGCTACG 120


7853R-2.IR full       121 GACTGCTGGACTTTGCGGCAGCCACCTGCATGTGCATCGGATTGGCCTGGTTCACGCTGG 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7853R-2.in silico     121 GACTGCTGGACTTTGCGGCAGCCACCTGCATGTGCATCGGATTGGCCTGGTTCACGCTGG 180


7853R-2.IR full       181 CCGACTCCCAGATGACGCCCAATTTCAATTTGCTTGGTGTGGCCATGATTTCGGGAGCGC 240
                          ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||
7853R-2.in silico     181 CCGACTCCCAGATGACGCCCAATTTCAATCTGCTTGGTGTGGCCATGATTTCGGGAGCGC 240


7853R-2.IR full       241 TGCTCTGCGACGCAGCCATTGGCAATGTCCAGGAGAAGGCGATGCGGGAATTCAAGGCGC 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7853R-2.in silico     241 TGCTCTGCGACGCAGCCATTGGCAATGTCCAGGAGAAGGCGATGCGGGAATTCAAGGCGC 300


7853R-2.IR full       301 CCAGCAGTGAGGTGGTGTTCTACTCATACGGCTTGGGTTTTGTGTACCTATTTGTGATTA 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7853R-2.in silico     301 CCAGCAGTGAGGTGGTGTTCTACTCATACGGCTTGGGTTTTGTGTACCTATTTGTGATTA 360


7853R-2.IR full       361 TGCTGGTTACCGGCAACTTCTTCAGCGGCTTTGCATTCTGTTTGGAGCATCCCGTTGAGA 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7853R-2.in silico     361 TGCTGGTTACCGGCAACTTCTTCAGCGGCTTTGCATTCTGTTTGGAGCATCCCGTTGAGA 420


7853R-2.IR full       421 CCTTCGGCTATGGCTTCCTCTTTAGTTTGTCCGGCTATCTGGGCATTCAGTTTGTGCTGG 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7853R-2.in silico     421 CCTTCGGCTATGGCTTCCTCTTTAGTTTGTCCGGCTATCTGGGCATTCAGTTTGTGCTGG 480


7853R-2.IR full       481 CTCTGGTGAGGAGTAGTGGTG 501
                          |||||||||||||||||||| 
7853R-2.in silico     481 CTCTGGTGAGGAGTAGTGGT- 501

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100  482  NM_140697.2  CG7853-RA (CG7853), mRNA 
0.41  NM_142497.2  CG18208-RA (CG18208), mRNA 
0.2  NM_079878.3  cubitus interruptus CG2125-RA (ci), mRNA 
0.2  NM_134962.2  CG31772-RA (CG31772), mRNA 
0.2  NM_206052.1  CG12822-RB, transcript variant B (CG12822), mRNA 
0.2  NM_136483.2  CG12822-RA, transcript variant A (CG12822), mRNA 
0.2  NM_165566.1  CG18853-RA (CG18853), mRNA 
0.2  14  NM_132642.2  CG15744-RA (CG15744), mRNA 
NM_058019.3  Ts CG3181-RA (Ts), mRNA 
NM_134975.2  CG3702-RA (CG3702), mRNA 
NM_136206.1  CG2617-RA (CG2617), mRNA 
NM_176065.1  Hormone receptor-like in 38 CG1864-RC, transcript variant C (Hr38), mRNA 
NM_176242.1  grauzone CG33133-RA (grau), mRNA 
NM_167641.1  CG14195-RA (CG14195), mRNA 
NM_169133.1  Osiris 16 CG31561-RA (Osi16), mRNA 
NM_057771.2  Hormone receptor-like in 38 CG1864-RB, transcript variant B (Hr38), mRNA 
NM_140196.2  CG7600-RA (CG7600), mRNA 
NM_134603.1  Pros45 CG1489-RA (Pros45), mRNA 
NM_167346.1  hemipterous CG4353-RA, transcript variant A (hep), mRNA 
NM_167347.1  hemipterous CG4353-RB, transcript variant B (hep), mRNA 
NM_079952.2  fusilli CG8205-RD, transcript variant D (fus), mRNA 
NM_166109.1  fusilli CG8205-RB, transcript variant B (fus), mRNA 
NM_166107.1  fusilli CG8205-RE, transcript variant E (fus), mRNA 
NM_166108.1  fusilli CG8205-RF, transcript variant F (fus), mRNA 
NM_001015213.1  CG40160-PB.3 (CG40160), mRNA 
NM_001015214.1  CG40160-PC.3 (CG40160), mRNA 
NM_001015212.1  CG40160-PA.3 (CG40160), mRNA 
NM_169565.1  CG9924-RA, transcript variant A (CG9924), mRNA 
NM_001038965.1  CG9924-RE, transcript variant E (CG9924), mRNA 
NM_169564.1  CG9924-RD, transcript variant D (CG9924), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.