National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 7830R-1 
 Symbol CG7830  Full Name CG7830 
 CG No CG7830  Old CG No CG7830 
 Synonyms CG7830 
 Accession No (Link to NCBI) NM_135360.3 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Ito S, Ueda T, Ueno A, Nakagawa H, Taniguchi H, Kayukawa N, Miki T.
A genetic screen in Drosophila for regulators of human prostate cancer progression.
Biochem. Biophys. Res. Commun. (2014) 451(4) 548-55 [ PubMed ID = 25117438 ] [ RRC reference ]

Álvarez-Fernández C, Tamirisa S, Prada F, Chernomoretz A, Podhajcer O, Blanco E, Martín-Blanco E.
Identification and functional analysis of healing regulators in Drosophila.
PLoS Genet. (2015) 11(2) e1004965 [ PubMed ID = 25647511 ] [ RRC reference ]

Umetsu D, Dunst S, Dahmann C.
An RNA interference screen for genes required to shape the anteroposterior compartment boundary in Drosophila identifies the Eph receptor.
PLoS ONE (2014) 9(12) e114340 [ PubMed ID = 25473846 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgCTCAGCGGTCTGCTGGTAGTG 
 Primer Seq. 3'
aatctagaggtaccATGGTGATGTCCGTTCGCTCG 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 CTCAGCGgtC TGCTGGTAGT GGCGTTATTC GCTATTTACG CAGCCGCGCA ATCAAAATCG 
0061 AAGACGGGAC TCTCGCTGTC GGAAAAAGTA CAAAACCTGG TGGACATGAA CGCCAAAAAG 
0121 CCGCTGCTCC GCNTTCAATG GACCCAAGTT TCGGGAGTAT GTGAAGAGTG CACCACGGAA 
0181 TTACTCGATG ATCGTAATGC TCACCGCATT GGCTCCATCG AGACAATGCC AGATCTGTAG 
0241 GCACGCCCAC GACGAGTTCG CCATCGTGGC CAACTCCTAC CGCTTCTCCT CGACTTACTC 
0301 CAACAAACTC TTCTTTGCTA TGGTGGATTT CGATGANGGC TCCGAGGTTT TCCAACTTCT 
0361 GCGCCTGAAC ACCGCCCCGG TGTTCATGCA TTTCCCgGCC AAgGGCAAGC CAAAGGGAGC 
0421 TGACACCATG GATATCCAtc gcgtNGNCTT CGCCGCCGAT TCTATTGCGA AATTCGTTGC 
0481 CGAGCGAACG GACATCACCA T 
 in silico PCR Fragment
0001 CTCAGCGGTC TGCTGGTAGT GGCGTTATTC GCTATTTACG CAGCCGCGCA ATCAAAATCG 
0061 AAGACGGGAC TCTCGCTGTC GGAAAAAGTA CAAAACCTGG TGGACATGAA CGCCAAAAAG 
0121 CCGCTGCTCC GC-TTCAATG GACCCAAGTT TCGGGAGTAT GTGAAGAGTG CACCACGGAA 
0181 TTACTCGATG ATCGTAATGC TCACCGCATT GGCTCCATCG AGACAATGCC AGATCTGTAG 
0241 GCACGCCCAC GACGAGTTCG CCATCGTGGC CAACTCCTAC CGCTTCTCCT CGACTTACTC 
0301 CAACAAACTC TTCTTTGCTA TGGTGGATTT CGATGACGGC TCCGAGGTTT TCCAACTTCT 
0361 GCGCCTGAAC ACCGCCCCGG TGTTCATGCA TTTCCCGGCC AAGGGCAAGC CAAAGGGAGC 
0421 TGACACCATG GATATCCATC GCGTCGGCTT CGCCGCCGAT TCTATTGCGA AATTCGTTGC 
0481 CGAGCGAACG GACATCACCA T 
 Assemble Data

7830R-1.IR_full       1   CTCAGCGGTCTGCTGGTAGTGGCGTTATTCGCTATTTACGCAGCCGCGCAATCAAAATCG 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7830R-1.in silico     1   CTCAGCGGTCTGCTGGTAGTGGCGTTATTCGCTATTTACGCAGCCGCGCAATCAAAATCG 60


7830R-1.IR_full       61  AAGACGGGACTCTCGCTGTCGGAAAAAGTACAAAACCTGGTGGACATGAACGCCAAAAAG 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7830R-1.in silico     61  AAGACGGGACTCTCGCTGTCGGAAAAAGTACAAAACCTGGTGGACATGAACGCCAAAAAG 120


7830R-1.IR_full       121 CCGCTGCTCCGCNTTCAATGGACCCAAGTTTCGGGAGTATGTGAAGAGTGCACCACGGAA 180
                          |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||
7830R-1.in silico     121 CCGCTGCTCCGC-TTCAATGGACCCAAGTTTCGGGAGTATGTGAAGAGTGCACCACGGAA 180


7830R-1.IR_full       181 TTACTCGATGATCGTAATGCTCACCGCATTGGCTCCATCGAGACAATGCCAGATCTGTAG 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7830R-1.in silico     181 TTACTCGATGATCGTAATGCTCACCGCATTGGCTCCATCGAGACAATGCCAGATCTGTAG 240


7830R-1.IR_full       241 GCACGCCCACGACGAGTTCGCCATCGTGGCCAACTCCTACCGCTTCTCCTCGACTTACTC 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7830R-1.in silico     241 GCACGCCCACGACGAGTTCGCCATCGTGGCCAACTCCTACCGCTTCTCCTCGACTTACTC 300


7830R-1.IR_full       301 CAACAAACTCTTCTTTGCTATGGTGGATTTCGATGANGGCTCCGAGGTTTTCCAACTTCT 360
                          |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
7830R-1.in silico     301 CAACAAACTCTTCTTTGCTATGGTGGATTTCGATGACGGCTCCGAGGTTTTCCAACTTCT 360


7830R-1.IR_full       361 GCGCCTGAACACCGCCCCGGTGTTCATGCATTTCCCGGCCAAGGGCAAGCCAAAGGGAGC 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7830R-1.in silico     361 GCGCCTGAACACCGCCCCGGTGTTCATGCATTTCCCGGCCAAGGGCAAGCCAAAGGGAGC 420


7830R-1.IR_full       421 TGACACCATGGATATCCATCGCGTNGNCTTCGCCGCCGATTCTATTGCGAAATTCGTTGC 480
                          |||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||
7830R-1.in silico     421 TGACACCATGGATATCCATCGCGTCGGCTTCGCCGCCGATTCTATTGCGAAATTCGTTGC 480


7830R-1.IR_full       481 CGAGCGAACGGACATCACCAT 501
                          |||||||||||||||||||||
7830R-1.in silico     481 CGAGCGAACGGACATCACCAT 501

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  15  NM_135360.3  CG7830-RA (CG7830), mRNA 
0   NM_142359.2  CG31256-RA (Brf), mRNA 
0   NM_176734.1  CG33206-RA, transcript variant A (l(1)G0168), mRNA 
0   NM_176735.1  CG33206-RB, transcript variant B (l(1)G0168), mRNA 
0   NM_136244.2  CG9256-RB, transcript variant B (Nhe2), mRNA 
0   NM_165355.1  CG9256-RA, transcript variant A (Nhe2), mRNA 
0   NM_131924.2  CG4857-RB (CG4857), mRNA 
0   NM_057942.3  CG5227-RC, transcript variant C (sdk), mRNA 
0   NM_134315.2  CG5227-RD, transcript variant D (sdk), mRNA 
0   NM_057941.3  CG5227-RA, transcript variant A (sdk), mRNA 
0   NM_134314.2  CG5227-RB, transcript variant B (sdk), mRNA 
0   NM_001014599.1  CG9390-RC, transcript variant C (AcCoAS), mRNA 
0   NM_168894.1  CG9390-RA, transcript variant A (AcCoAS), mRNA 
0   NM_079472.2  CG9390-RB, transcript variant B (AcCoAS), mRNA 
0   NM_136921.1  CG13162-RA (CG13162), mRNA 
0   NM_142598.1  CG17190-RA (CG17190), mRNA 
0   NM_170375.1  CG31050-RA (CG31050), mRNA 
0   NM_136202.4  CG31678-RA (CG31678), mRNA 
0   NM_057861.2  CG3425-RA (T3dh), mRNA 
0   NM_140523.2  CG7764-RA (Tfb2), mRNA 
0   NM_137278.1  CG15710-RA (CG15710), mRNA 
0   NM_138003.2  CG5591-RA (CG5591), mRNA 
0   NM_137616.2  CG11208-RA (CG11208), mRNA 
0   NM_130715.2  CG13316-RB, transcript variant B (Mnt), mRNA 
0   NM_167565.1  CG8649-RD, transcript variant D (Fim), mRNA 
0   NM_137455.4  CG10915-RA (CG10915), mRNA 
0   NM_167564.1  CG8649-RC, transcript variant C (Fim), mRNA 
0   NM_078661.3  CG8649-RA, transcript variant A (Fim), mRNA 
0   NM_138049.2  CG3328-RA (CG3328), mRNA 
0   NM_142995.2  CG5762-RA (CG5762), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.