National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 7788R-2 
 Symbol Ice  Full Name Ice 
 CG No CG7788  Old CG No CG7788 
 Synonyms drICE, Drice, drice, DrICE, DRICE, ICE, CG7788, DrIce, ice, Ice, caspase 3 
 Accession No (Link to NCBI) NM_079827.2 
 Inserted Chr.
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Khammari A, Agn├Ęs F, Gandille P, Pret AM.
Physiological apoptosis of polar cells during Drosophila oogenesis is mediated by Hid-dependent regulation of Diap1.
Cell Death Differ. (2011) 18(5) 793-805 [ PubMed ID = 21113144 ] [ RRC reference ]

Tsai CR, Anderson AE, Burra S, Jo J, Galko MJ.
Yorkie regulates epidermal wound healing in Drosophila larvae independently of cell proliferation and apoptosis.
Dev. Biol. (2017) 427(1) 61-71 [ PubMed ID = 28514643 ] [ RRC reference ]

Zhang S, Chen C, Wu C, Yang Y, Li W, Xue L.
The canonical Wg signaling modulates Bsk-mediated cell death in Drosophila.
Cell Death Dis (2015) 6 e1713 [ PubMed ID = 25855961 ] [ RRC reference ]

Leulier F, Ribeiro PS, Palmer E, Tenev T, Takahashi K, Robertson D, Zachariou A, Pichaud F, Ueda R, Meier P.
Systematic in vivo RNAi analysis of putative components of the Drosophila cell death machinery.
Cell Death Differ. (2006) 13(10) 1663-74 [ PubMed ID = 16485033 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgGATCCTCGCATCCTTACGGCA 
 Primer Seq. 3'
aatctagaggtaccCTGGCAGGCCTGTATGAAGAA 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 NATCCTCGCA TCCTTACGGC AGCGGAGccA TTGGGCAGCT GGcCAACGGG TACAGCTCAC 
0061 CCTCGTCCAG CTACCGNAAG AATGTAGCCA AAATGGTCAC CGACCGCCAT GCAGCCGAGT 
0121 ACAACATGCG CCACAAGAAC CGCGGAATGG CACTGATCTT CAACCATGAG CACTTCGAGG 
0181 TGCCCACCTT GAAGTCTCGC GCGGNAACCA ATGTGGACTG CGAGAATCTG ACTCGGGTGC 
0241 TCAAGCAGCT GGACTTCGAA GTGACCGTGT ACAAGGACTG CCGCTACAAG GACATTTTGA 
0301 GGACAATCGA GTATGCAGCG TCGCAGAATC ACAGCGATAG TGATTGTATC CTGGTCGCCA 
0361 TCCTGTCGCA CGGCGAGATG GGCTACATCT ACGCCAAGGA CACACAGTAC AAGCTGGATA 
0421 ACATCTGGAG CTTCTTCACG GCCAATCACT GCCCCTCGCT AGCCGGCAAA CCCAAGTTGT 
0481 TCTTCATACA GGCCTGCCAG  
 in silico PCR Fragment
0001 GATCCTCGCA TCCTTACGGC AGCGGAGCCA TTGGGCAGCT GGCCAACGGG TACAGCTCAC 
0061 CCTCGTCCAG CTACCGTAAG AATGTAGCCA AAATGGTCAC CGACCGCCAT GCAGCCGAGT 
0121 ACAACATGCG CCACAAGAAC CGCGGAATGG CACTGATCTT CAACCATGAG CACTTCGAGG 
0181 TGCCCACCTT GAAGTCTCGC GCGGGAACCA ATGTGGACTG CGAGAATCTG ACTCGGGTGC 
0241 TCAAGCAGCT GGACTTCGAA GTGACCGTGT ACAAGGACTG CCGCTACAAG GACATTTTGA 
0301 GGACAATCGA GTATGCAGCG TCGCAGAATC ACAGCGATAG TGATTGCATC CTGGTCGCCA 
0361 TCCTGTCGCA CGGCGAGATG GGCTACATCT ACGCCAAGGA CACACAGTAC AAGCTGGATA 
0421 ACATCTGGAG CTTCTTCACG GCCAATCACT GCCCCTCGCT AGCCGGCAAA CCCAAGTTGT 
0481 TCTTCATACA GGCCTGCCAG  
 Assemble Data

7788R-2.IR_full        1   ATCCTCGCATCCTTACGGCAGCGGAGCCATTGGGCAGCTGGCCAACGGGTACAGCTCAC 59
                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7788R-2.in silico      1   ATCCTCGCATCCTTACGGCAGCGGAGCCATTGGGCAGCTGGCCAACGGGTACAGCTCAC 59


7788R-2.IR_full       61  CCTCGTCCAGCTACCGNAAGAATGTAGCCAAAATGGTCACCGACCGCCATGCAGCCGAGT 119
                          |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||
7788R-2.in silico     61  CCTCGTCCAGCTACCGTAAGAATGTAGCCAAAATGGTCACCGACCGCCATGCAGCCGAGT 119


7788R-2.IR_full       121 ACAACATGCGCCACAAGAACCGCGGAATGGCACTGATCTTCAACCATGAGCACTTCGAGG 179
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7788R-2.in silico     121 ACAACATGCGCCACAAGAACCGCGGAATGGCACTGATCTTCAACCATGAGCACTTCGAGG 179


7788R-2.IR_full       181 TGCCCACCTTGAAGTCTCGCGCGGNAACCAATGTGGACTGCGAGAATCTGACTCGGGTGC 239
                          |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||
7788R-2.in silico     181 TGCCCACCTTGAAGTCTCGCGCGGGAACCAATGTGGACTGCGAGAATCTGACTCGGGTGC 239


7788R-2.IR_full       241 TCAAGCAGCTGGACTTCGAAGTGACCGTGTACAAGGACTGCCGCTACAAGGACATTTTGA 299
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7788R-2.in silico     241 TCAAGCAGCTGGACTTCGAAGTGACCGTGTACAAGGACTGCCGCTACAAGGACATTTTGA 299


7788R-2.IR_full       301 GGACAATCGAGTATGCAGCGTCGCAGAATCACAGCGATAGTGATTGTATCCTGGTCGCCA 359
                          |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||
7788R-2.in silico     301 GGACAATCGAGTATGCAGCGTCGCAGAATCACAGCGATAGTGATTGCATCCTGGTCGCCA 359


7788R-2.IR_full       361 TCCTGTCGCACGGCGAGATGGGCTACATCTACGCCAAGGACACACAGTACAAGCTGGATA 419
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7788R-2.in silico     361 TCCTGTCGCACGGCGAGATGGGCTACATCTACGCCAAGGACACACAGTACAAGCTGGATA 419


7788R-2.IR_full       421 ACATCTGGAGCTTCTTCACGGCCAATCACTGCCCCTCGCTAGCCGGCAAACCCAAGTTGT 479
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7788R-2.in silico     421 ACATCTGGAGCTTCTTCACGGCCAATCACTGCCCCTCGCTAGCCGGCAAACCCAAGTTGT 479


7788R-2.IR_full       481 TCTTCATACAGGCCTGCCAG 499
                          ||||||||||||||||||||
7788R-2.in silico     481 TCTTCATACAGGCCTGCCAG 499

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_079827.2  CG7788-RA (Ice), mRNA 
0.2   NM_001043217.1  CG34113-RP, transcript variant P (CG34113), mRNA 
0.2   NM_001043216.1  CG34113-RO, transcript variant O (CG34113), mRNA 
0   31  66  NM_057626.3  CG5370-RA (Dcp-1), mRNA 
0   NM_142487.1  CG7709-RA (CG7709), mRNA 
0   NM_142112.2  CG8279-RA (Pde6), mRNA 
0   NM_165461.1  CG1765-RA, transcript variant A (EcR), mRNA 
0   NM_134880.1  CG3104-RA, transcript variant A (CG3104), mRNA 
0   NM_164505.1  CG3104-RB, transcript variant B (CG3104), mRNA 
0   NM_164749.1  CG5261-RA, transcript variant A (CG5261), mRNA 
0   NM_135274.2  CG5261-RB, transcript variant B (CG5261), mRNA 
0   NM_134864.3  CG2848-RA (Trn-SR), mRNA 
0   NM_135922.2  CG3793-RA (CG3793), mRNA 
0   NM_136647.2  CG8809-RA (Camta), mRNA 
0   NM_079458.2  CG5517-RA (Ide), mRNA 
0   NM_001043240.1  CG34114-RB (CG34114), mRNA 
0   NM_139808.1  CG10064-RA (CG10064), mRNA 
0   NM_165325.1  CG10076-RC, transcript variant C (spir), mRNA 
0   NM_080115.2  CG10076-RB, transcript variant B (spir), mRNA 
0   NM_165323.1  CG10076-RA, transcript variant A (spir), mRNA 
0   NM_135892.2  CG4185-RA (NC2beta), mRNA 
0   NM_139791.1  CG10144-RA (CG10144), mRNA 
0   NM_132871.2  CG8939-RA (CG8939), mRNA 
0   NM_143627.1  CG11563-RA (CG11563), mRNA 
0   NM_169698.1  CG5000-RA (msps), mRNA 
0   NM_001014545.1  CG33519-RB (Unc-89), mRNA 
0   NM_057243.3  CG3228-RA (kz), mRNA 
0   NM_057598.3  CG10739-RA (pigeon), mRNA 
0   NM_001038906.1  CG17352-RD, transcript variant D (CG17352), mRNA 
0   NM_139957.2  CG17352-RC, transcript variant C (CG17352), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.