National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 7788R-2 
 Symbol Ice  Full Name Ice 
 CG No CG7788  Old CG No CG7788 
 Synonyms drICE, Drice, drice, DrICE, DRICE, ICE, CG7788, DrIce, ice, Ice, caspase 3 
 Accession No (Link to NCBI) NM_079827.2 
 Inserted Chr.
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
[Please submit your publication]
Li M, Sun S, Priest J, Bi X, Fan Y.
Characterization of TNF-induced cell death in Drosophila reveals caspase- and JNK-dependent necrosis and its role in tumor suppression.
Cell Death Dis (2019) 10(8) 613 [ PubMed ID = 31409797 ] [ RRC reference ]

Khammari A, Agn├Ęs F, Gandille P, Pret AM.
Physiological apoptosis of polar cells during Drosophila oogenesis is mediated by Hid-dependent regulation of Diap1.
Cell Death Differ. (2011) 18(5) 793-805 [ PubMed ID = 21113144 ] [ RRC reference ]

Zhang S, Chen C, Wu C, Yang Y, Li W, Xue L.
The canonical Wg signaling modulates Bsk-mediated cell death in Drosophila.
Cell Death Dis (2015) 6 e1713 [ PubMed ID = 25855961 ] [ RRC reference ]

Tsai CR, Anderson AE, Burra S, Jo J, Galko MJ.
Yorkie regulates epidermal wound healing in Drosophila larvae independently of cell proliferation and apoptosis.
Dev. Biol. (2017) 427(1) 61-71 [ PubMed ID = 28514643 ] [ RRC reference ]

Leulier F, Ribeiro PS, Palmer E, Tenev T, Takahashi K, Robertson D, Zachariou A, Pichaud F, Ueda R, Meier P.
Systematic in vivo RNAi analysis of putative components of the Drosophila cell death machinery.
Cell Death Differ. (2006) 13(10) 1663-74 [ PubMed ID = 16485033 ] [ RRC reference ]  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico      1   ATCCTCGCATCCTTACGGCAGCGGAGCCATTGGGCAGCTGGCCAACGGGTACAGCTCAC 59

                          |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| silico     61  CCTCGTCCAGCTACCGTAAGAATGTAGCCAAAATGGTCACCGACCGCCATGCAGCCGAGT 119

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     121 ACAACATGCGCCACAAGAACCGCGGAATGGCACTGATCTTCAACCATGAGCACTTCGAGG 179

                          |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| silico     181 TGCCCACCTTGAAGTCTCGCGCGGGAACCAATGTGGACTGCGAGAATCTGACTCGGGTGC 239

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     241 TCAAGCAGCTGGACTTCGAAGTGACCGTGTACAAGGACTGCCGCTACAAGGACATTTTGA 299

                          |||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| silico     301 GGACAATCGAGTATGCAGCGTCGCAGAATCACAGCGATAGTGATTGCATCCTGGTCGCCA 359

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     361 TCCTGTCGCACGGCGAGATGGGCTACATCTACGCCAAGGACACACAGTACAAGCTGGATA 419

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     421 ACATCTGGAGCTTCTTCACGGCCAATCACTGCCCCTCGCTAGCCGGCAAACCCAAGTTGT 479

7788R-2.IR_full       481 TCTTCATACAGGCCTGCCAG 499
                          |||||||||||||||||||| silico     481 TCTTCATACAGGCCTGCCAG 499

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_079827.2  CG7788-RA (Ice), mRNA 
0.2   NM_001043217.1  CG34113-RP, transcript variant P (CG34113), mRNA 
0.2   NM_001043216.1  CG34113-RO, transcript variant O (CG34113), mRNA 
0   31  66  NM_057626.3  CG5370-RA (Dcp-1), mRNA 
0   NM_142487.1  CG7709-RA (CG7709), mRNA 
0   NM_142112.2  CG8279-RA (Pde6), mRNA 
0   NM_165461.1  CG1765-RA, transcript variant A (EcR), mRNA 
0   NM_134880.1  CG3104-RA, transcript variant A (CG3104), mRNA 
0   NM_164505.1  CG3104-RB, transcript variant B (CG3104), mRNA 
0   NM_164749.1  CG5261-RA, transcript variant A (CG5261), mRNA 
0   NM_135274.2  CG5261-RB, transcript variant B (CG5261), mRNA 
0   NM_134864.3  CG2848-RA (Trn-SR), mRNA 
0   NM_135922.2  CG3793-RA (CG3793), mRNA 
0   NM_136647.2  CG8809-RA (Camta), mRNA 
0   NM_079458.2  CG5517-RA (Ide), mRNA 
0   NM_001043240.1  CG34114-RB (CG34114), mRNA 
0   NM_139808.1  CG10064-RA (CG10064), mRNA 
0   NM_165325.1  CG10076-RC, transcript variant C (spir), mRNA 
0   NM_080115.2  CG10076-RB, transcript variant B (spir), mRNA 
0   NM_165323.1  CG10076-RA, transcript variant A (spir), mRNA 
0   NM_135892.2  CG4185-RA (NC2beta), mRNA 
0   NM_139791.1  CG10144-RA (CG10144), mRNA 
0   NM_132871.2  CG8939-RA (CG8939), mRNA 
0   NM_143627.1  CG11563-RA (CG11563), mRNA 
0   NM_169698.1  CG5000-RA (msps), mRNA 
0   NM_001014545.1  CG33519-RB (Unc-89), mRNA 
0   NM_057243.3  CG3228-RA (kz), mRNA 
0   NM_057598.3  CG10739-RA (pigeon), mRNA 
0   NM_001038906.1  CG17352-RD, transcript variant D (CG17352), mRNA 
0   NM_139957.2  CG17352-RC, transcript variant C (CG17352), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.