National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 7777R-2 
 Symbol CG7777  Full Name CG7777 
 CG No CG7777  Old CG No CG7777 
 Synonyms CG7777 
 Accession No (Link to NCBI) NM_165834.1 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
Cabrero P, Terhzaz S, Dornan AJ, Ghimire S, Holmes HL, Turin DR, Romero MF, Davies SA, Dow JAT.
Specialized stellate cells offer a privileged route for rapid water flux in Drosophila renal tubule.
Proc. Natl. Acad. Sci. U.S.A. (2020) [ PubMed ID = 31907321 ] [ RRC reference ]

Umemori M, Habara O, Iwata T, Maeda K, Nishinoue K, Okabe A, Takemura M, Takahashi K, Saigo K, Ueda R, Adachi-Yamada T.
RNAi-mediated knockdown showing impaired cell survival in Drosophila wing imaginal disc.
Gene Regul Syst Bio (2009) 3 11-20 [ PubMed ID = 19838331 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgGGCGCATGCACCCAAATTGAG 
 Primer Seq. 3'
aatctagaggtaccGCCCAGATGTCGGTGGCAAAG 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 ggcGNATGCA CCCAAATTGA GGATGGCACC TTCAAGGCCT TGGcTTTTGG CCTGGCTATC 
0061 TTCATGGCCA TCACGATTGT GGGCCACTTG AGTGGTGGTC ATGTGAATCC TGCCGTTACC 
0121 GCTGGAATGT TGGTCGCAGG ACGAATTAGC TTGATCAGAG CCTTTTTCTA TGTGGTTTTC 
0181 CAGTGCTTGG GTGCAATTGC CGGAACTGCA GCGGTTAAGA TTCTCATCGA TCAGGACTAT 
0241 TACAATGGCC TGGGTCACAC CTCTCTGGCG CCCAATATCA CCGAGCTGCA GGGCCTGGGA 
0301 ATCGAGTTCT TCCTGGGACT CCTGCTGGTG CTCGTCGTCT TTGGGGTCTG TGATCCCCAC 
0361 AAGCCCGATT CCCGCTACAC GGCGCCCTTG GCCATCGGAA TGGCgGNGAC CCTGGGTCAC 
0421 TTGGGCACCA TCCGCTACAC CGGGGCCAGC ATGAATCCCG CTCGCACCGT GGgcACCNCC 
0481 TTTGCCACCG ACATCTGGGC  
 in silico PCR Fragment
0001 GGCGCATGCA CCCAAATTGA GGATGGCACC TTCAAGGCCT TGGCTTTTGG CCTGGCTATC 
0061 TTCATGGCCA TCACGATTGT GGGCCACTTG AGTGGTGGTC ATGTGAATCC TGCCGTTACC 
0121 GCTGGAATGT TGGTCGCAGG ACGAATTAGC TTGATCAGAG CCTTTTTCTA TGTGGTTTTC 
0181 CAGTGCTTGG GTGCAATTGC CGGAACTGCA GCGGTTAAGA TTCTCATCGA TCAGGACTAT 
0241 TACAATGGCC TGGGTCACAC CTCTCTGGCG CCCAATATCA CCGAGCTGCA GGGCCTGGGA 
0301 ATCGAGTTCT TCCTGGGACT CCTGCTGGTG CTCGTCGTCT TTGGGGCCTG TGATCCCCAC 
0361 AAGCCCGATT CCCGCTACAC GGCGCCCTTG GCCATCGGAA TGGCGGTGAC CCTGGGTCAC 
0421 TTGGGCACCA TCCGCTACAC CGGGGCCAGC ATGAATCCCG CTCGCACCGT GGGCACCGCC 
0481 TTTGCCACCG ACATCTGGGC  
 Assemble Data

7777R-2.IR_full       1   GGCGNATGCACCCAAATTGAGGATGGCACCTTCAAGGCCTTGGCTTTTGGCCTGGCTATC 60
                          |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||
7777R-2.in silico     1   GGCGCATGCACCCAAATTGAGGATGGCACCTTCAAGGCCTTGGCTTTTGGCCTGGCTATC 60


7777R-2.IR_full       61  TTCATGGCCATCACGATTGTGGGCCACTTGAGTGGTGGTCATGTGAATCCTGCCGTTACC 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7777R-2.in silico     61  TTCATGGCCATCACGATTGTGGGCCACTTGAGTGGTGGTCATGTGAATCCTGCCGTTACC 120


7777R-2.IR_full       121 GCTGGAATGTTGGTCGCAGGACGAATTAGCTTGATCAGAGCCTTTTTCTATGTGGTTTTC 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7777R-2.in silico     121 GCTGGAATGTTGGTCGCAGGACGAATTAGCTTGATCAGAGCCTTTTTCTATGTGGTTTTC 180


7777R-2.IR_full       181 CAGTGCTTGGGTGCAATTGCCGGAACTGCAGCGGTTAAGATTCTCATCGATCAGGACTAT 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7777R-2.in silico     181 CAGTGCTTGGGTGCAATTGCCGGAACTGCAGCGGTTAAGATTCTCATCGATCAGGACTAT 240


7777R-2.IR_full       241 TACAATGGCCTGGGTCACACCTCTCTGGCGCCCAATATCACCGAGCTGCAGGGCCTGGGA 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7777R-2.in silico     241 TACAATGGCCTGGGTCACACCTCTCTGGCGCCCAATATCACCGAGCTGCAGGGCCTGGGA 300


7777R-2.IR_full       301 ATCGAGTTCTTCCTGGGACTCCTGCTGGTGCTCGTCGTCTTTGGGGTCTGTGATCCCCAC 360
                          |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||
7777R-2.in silico     301 ATCGAGTTCTTCCTGGGACTCCTGCTGGTGCTCGTCGTCTTTGGGGCCTGTGATCCCCAC 360


7777R-2.IR_full       361 AAGCCCGATTCCCGCTACACGGCGCCCTTGGCCATCGGAATGGCGGNGACCCTGGGTCAC 420
                          |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||
7777R-2.in silico     361 AAGCCCGATTCCCGCTACACGGCGCCCTTGGCCATCGGAATGGCGGTGACCCTGGGTCAC 420


7777R-2.IR_full       421 TTGGGCACCATCCGCTACACCGGGGCCAGCATGAATCCCGCTCGCACCGTGGGCACCNCC 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||
7777R-2.in silico     421 TTGGGCACCATCCGCTACACCGGGGCCAGCATGAATCCCGCTCGCACCGTGGGCACCGCC 480


7777R-2.IR_full       481 TTTGCCACCGACATCTGGGC 500
                          ||||||||||||||||||||
7777R-2.in silico     481 TTTGCCACCGACATCTGGGC 500

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_136842.2  CG7777-RB, transcript variant B (CG7777), mRNA 
100   482  NM_165834.1  CG7777-RA, transcript variant A (CG7777), mRNA 
0.2   NM_133110.2  CG7332-RA (CG7332), mRNA 
0.2   NM_079079.2  CG9709-RA (Acox57D-d), mRNA 
0   NM_165833.2  CG9023-RA, transcript variant A (Drip), mRNA 
0   NM_078973.2  CG9023-RB, transcript variant B (Drip), mRNA 
0   NM_132675.2  CG11177-RA (BthD), mRNA 
0   NM_078604.3  CG32592-RA (hiw), mRNA 
0   NM_168246.1  CG8042-RB, transcript variant B (CG8042), mRNA 
0   NM_139908.2  CG8042-RA, transcript variant A (CG8042), mRNA 
0   NM_144362.1  CG15902-RA (Ugt86Dj), mRNA 
0   NM_058143.3  CG3218-RA (fs(1)K10), mRNA 
0   NM_164967.1  CG6509-RA, transcript variant A (CG6509), mRNA 
0   NM_135661.2  CG6509-RB, transcript variant B (CG6509), mRNA 
0   NM_143782.2  CG3820-RA (Nup214), mRNA 
0   NM_078944.4  CG1519-RB, transcript variant B (Prosalpha7), mRNA 
0   NM_165703.1  CG1519-RA, transcript variant A (Prosalpha7), mRNA 
0   NM_165582.1  CG8722-RB, transcript variant B (Nup44A), mRNA 
0   NM_165583.1  CG8722-RC, transcript variant C (Nup44A), mRNA 
0   NM_136499.2  CG8722-RA, transcript variant A (Nup44A), mRNA 
0   NM_140711.2  CG6479-RA, transcript variant A (CG6479), mRNA 
0   NM_168723.1  CG6479-RB, transcript variant B (CG6479), mRNA 
0   NM_078723.2  CG3022-RA, transcript variant A (GABA-B-R3), mRNA 
0   NM_057444.3  CG3757-RA (y), mRNA 
0   NM_078665.2  CG6352-RA (OdsH), mRNA 
0   11  NM_001032231.1  CG18003-RA, transcript variant A (CG18003), mRNA 
0   11  NM_001032232.1  CG11919-RA, transcript variant A (CG11919), mRNA 
0   NM_164719.1  CG32829-RA (CG32829), mRNA 
0   NM_132213.1  CG2260-RA (CG2260), mRNA 
0   NM_142845.1  CG13840-RA (CG13840), mRNA 
 Wing Disc
GFP
Puc
Caspase
DAPI
Merge
Figure
JNK signal
N
 
DB
DC
++ 
DM
 
VM
 
VB
 
Caspase-3 signal
N
 
DB
DC
++ 
DM
 
VM
 
VB
 
Dcompartment   Penetrance
   

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.