National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 7776R-2 
 Symbol E(Pc)  Full Name Enhancer of Polycomb 
 CG No CG7776  Old CG No CG7776 
 Synonyms CG7776, GH05739, GH14582, e(Pc), III, l(2)28-28-12, anon-48Ac, E(Pc) 
 Accession No (Link to NCBI) NM_078974.2 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Owusu-Ansah E, Banerjee U.
Reactive oxygen species prime Drosophila haematopoietic progenitors for differentiation.
Nature (2009) 461(7263) 537-41 [ PubMed ID = 19727075 ] [ RRC reference ]

Saj A, Arziman Z, Stempfle D, van Belle W, Sauder U, Horn T, D├╝rrenberger M, Paro R, Boutros M, Merdes G.
A combined ex vivo and in vivo RNAi screen for notch regulators in Drosophila reveals an extensive notch interaction network.
Dev. Cell (2010) 18(5) 862-76 [ PubMed ID = 20493818 ] [ RRC reference ]

Ohhara Y, Nakamura A, Kato Y, Yamakawa-Kobayashi K.
Chaperonin TRiC/CCT supports mitotic exit and entry into endocycle in Drosophila.
PLoS Genet. (2019) 15(4) e1008121 [ PubMed ID = 31034473 ] [ RRC reference ]

Umemori M, Habara O, Iwata T, Maeda K, Nishinoue K, Okabe A, Takemura M, Takahashi K, Saigo K, Ueda R, Adachi-Yamada T.
RNAi-mediated knockdown showing impaired cell survival in Drosophila wing imaginal disc.
Gene Regul Syst Bio (2009) 3 11-20 [ PubMed ID = 19838331 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgCATTTGGATCCGTCCAAGCAG 
 Primer Seq. 3'
aatctagaggtaccATCTTGAGGCGTTTGTTCAGC 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 CATTTGGATC CGTCCAAGCA GATGCCCATC TACTTGGCGG AGGAGCTGCC CGACCTCCCC 
0061 GAGTACTCAG CCATCAACCG GGCAGTGcCT CAAATGCCCA GTGGCATGGA GAAGGAGGAG 
0121 GAGTCGGAGC ACCACTTGCA GCGAGCGATA TGCACGGGTC TGATCATCCC CCACGCCCGA 
0181 GGTGCTGCAG ACGGATCAGC CCTTCTACGA TGCCTACTAT CCGCCGGACT ACAAAATGCC 
0241 CCGCCAAATG ATCCACATGC AACCTCTTGG GCTGGATACC GAGGTCCCTG ACTACGACAT 
0301 GGACAGTGCC GATGAGGACT GGCTCAGTCA GCAGCAGCGC CTGGAGCTTA CCGAACTCAA 
0361 GTTCGAGCAG ATGATGGACC GGCTAGAAAA GAGCTCCGGC CAAACGGTGG TCACGCTGAA 
0421 CGAGGCCAAG TCGCTGCTTA ACCAGGACGA CGAGACCAGC ATATCCGTCT ACGATTACTG 
0481 GCTGAACAAA CGCCTCAAGA T 
 in silico PCR Fragment
0001 CATTTGGATC CGTCCAAGCA GATGCCCATC TACTTGGCGG AGGAGCTGCC CGACCTCCCC 
0061 GAGTACTCAG CCATCAACCG GGCAGTGCCT CAAATGCCCA GTGGCATGGA GAAGGAGGAG 
0121 GAGTCGGAGC ACCACTTGCA GCGAGCGATA TGCACGGGTC TGATCAT-CC CCACGCCCGA 
0181 GGTGCTGCAG ACGGATCAGC CCTTCTACGA TGCCTACTAT CCGCCGGACT ACAAAATGCC 
0241 CCGCCAAATG ATCCACATGC AACCTCTTGG GCTGGATACC GAGGTCCCTG ACTACGACAT 
0301 GGACAGTGCC GATGAGGACT GGCTCAGTCA GCAGCAGCGC CTGGAGCTTA CCGAACTCAA 
0361 GTTCGAGCAG ATGATGGACC GGCTAGAAAA GAGCTCCGGC CAAACGGTGG TCACGCTGAA 
0421 CGAGGCCAAG TCGCTGCTTA ACCAGGACGA CGAGACCAGC ATATCCGTCT ACGATTACTG 
0481 GCTGAACAAA CGCCTCAAGA T 
 Assemble Data

7776R-2.IR_full       1   CATTTGGATCCGTCCAAGCAGATGCCCATCTACTTGGCGGAGGAGCTGCCCGACCTCCCC 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7776R-2.in silico     1   CATTTGGATCCGTCCAAGCAGATGCCCATCTACTTGGCGGAGGAGCTGCCCGACCTCCCC 60


7776R-2.IR_full       61  GAGTACTCAGCCATCAACCGGGCAGTGCCTCAAATGCCCAGTGGCATGGAGAAGGAGGAG 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7776R-2.in silico     61  GAGTACTCAGCCATCAACCGGGCAGTGCCTCAAATGCCCAGTGGCATGGAGAAGGAGGAG 120


7776R-2.IR_full       121 GAGTCGGAGCACCACTTGCAGCGAGCGATATGCACGGGTCTGATCATCCCCCACGCCCGA 180
                          ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||
7776R-2.in silico     121 GAGTCGGAGCACCACTTGCAGCGAGCGATATGCACGGGTCTGATCAT-CCCCACGCCCGA 180


7776R-2.IR_full       181 GGTGCTGCAGACGGATCAGCCCTTCTACGATGCCTACTATCCGCCGGACTACAAAATGCC 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7776R-2.in silico     181 GGTGCTGCAGACGGATCAGCCCTTCTACGATGCCTACTATCCGCCGGACTACAAAATGCC 240


7776R-2.IR_full       241 CCGCCAAATGATCCACATGCAACCTCTTGGGCTGGATACCGAGGTCCCTGACTACGACAT 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7776R-2.in silico     241 CCGCCAAATGATCCACATGCAACCTCTTGGGCTGGATACCGAGGTCCCTGACTACGACAT 300


7776R-2.IR_full       301 GGACAGTGCCGATGAGGACTGGCTCAGTCAGCAGCAGCGCCTGGAGCTTACCGAACTCAA 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7776R-2.in silico     301 GGACAGTGCCGATGAGGACTGGCTCAGTCAGCAGCAGCGCCTGGAGCTTACCGAACTCAA 360


7776R-2.IR_full       361 GTTCGAGCAGATGATGGACCGGCTAGAAAAGAGCTCCGGCCAAACGGTGGTCACGCTGAA 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7776R-2.in silico     361 GTTCGAGCAGATGATGGACCGGCTAGAAAAGAGCTCCGGCCAAACGGTGGTCACGCTGAA 420


7776R-2.IR_full       421 CGAGGCCAAGTCGCTGCTTAACCAGGACGACGAGACCAGCATATCCGTCTACGATTACTG 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7776R-2.in silico     421 CGAGGCCAAGTCGCTGCTTAACCAGGACGACGAGACCAGCATATCCGTCTACGATTACTG 480


7776R-2.IR_full       481 GCTGAACAAACGCCTCAAGAT 501
                          |||||||||||||||||||||
7776R-2.in silico     481 GCTGAACAAACGCCTCAAGAT 501

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_078974.2  CG7776-RA, transcript variant A (E(Pc)), mRNA 
100   482  NM_165836.1  CG7776-RB, transcript variant B (E(Pc)), mRNA 
0.2   NM_057313.3  CG3736-RA (okr), mRNA 
0   NM_001042804.1  CG2174-RB, transcript variant B (Myo10A), mRNA 
0   NM_132441.1  CG2174-RA, transcript variant A (Myo10A), mRNA 
0   NM_165009.1  CG31763-RA (CG31763), mRNA 
0   NM_164448.1  CG4244-RA, transcript variant A (Su(dx)), mRNA 
0   NM_132614.2  CG4396-RA (fne), mRNA 
0   NM_164449.1  CG4244-RC, transcript variant C (Su(dx)), mRNA 
0   NM_057405.2  CG4244-RB, transcript variant B (Su(dx)), mRNA 
0   NM_058136.3  CG4376-RA, transcript variant A (Actn), mRNA 
0   NM_166920.1  CG4376-RB, transcript variant B (Actn), mRNA 
0   NM_058137.3  CG4376-RC, transcript variant C (Actn), mRNA 
0   NM_176133.3  CG12052-RI, transcript variant I (lola), mRNA 
0   18  NM_134510.1  CG12703-RA (CG12703), mRNA 
0   NM_079067.2  CG11949-RA, transcript variant A (cora), mRNA 
0   NM_132967.1  CG5004-RA (CG5004), mRNA 
0   NM_144290.1  CG12643-RA (CG12643), mRNA 
0   NM_142993.2  CG17785-RA (Golgin84), mRNA 
0   NM_079237.1  CG4321-RA (Cyp4d8), mRNA 
0   NM_057282.3  CG4087-RA (RpLP1), mRNA 
0   NM_170189.1  CG31115-RA (CG31115), mRNA 
0   NM_079073.1  CG8595-RA (Toll-7), mRNA 
0   13  NM_167872.1  CG9155-RC, transcript variant C (Myo61F), mRNA 
0   13  NM_057586.3  CG9155-RD, transcript variant D (Myo61F), mRNA 
0   13  NM_167871.1  CG9155-RB, transcript variant B (Myo61F), mRNA 
0   13  NM_167870.1  CG9155-RA, transcript variant A (Myo61F), mRNA 
0   NM_001038734.1  CG16902-RC (Hr4), mRNA 
0   NM_079610.2  CG12358-RA (Paip2), mRNA 
0   NM_140522.1  CG16979-RA (CG16979), mRNA 
 Wing Disc
GFP
Puc
Caspase
DAPI
Merge
Figure
JNK signal
N
DB
++ 
DC
++ 
DM
++ 
VM
VB
+- 
Caspase-3 signal
N
DB
++ 
DC
++ 
DM
++ 
VM
++ 
VB
++ 
Dcompartment   Penetrance
++     

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.