National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 7723R-3 
 Symbol tinc  Full Name tincar 
 CG No CG31247  Old CG No CG7723 
 Synonyms CG7723, CG14320, CG14319, CG31247, tinc 
 Accession No (Link to NCBI) NM_176509.1 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Hirota Y, Sawamoto K, Takahashi K, Ueda R, Okano H.
The transmembrane protein, Tincar, is involved in the development of the compound eye in Drosophila melanogaster.
Dev. Genes Evol. (2005) 215(2) 90-6 [ PubMed ID = 15654626 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgAGCCTCAACTCCAGCCTCTGC 
 Primer Seq. 3'
aatctagaggtaccGTCCAAAGGGCTCGAAGGGTG 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 AGCCTCAACT CCAGCCTCTG CAATTCCGTA ATGACGAACG CCACAACGGC GAGCAGCAGC 
0061 CTCACGCAAC AGCAGCAGCA GCTCCAGGCC AAGTACATCA AATCGAAGCG CCACCAGAGC 
0121 CGCTACACCA GCCTCCAGCA CTCCGCGCCA CGATTCCGGC AGCTATCTGC ATCTGAACTC 
0181 GCTATGGTCG ATCTGGTACG GAGTGATGCT CACCCTGTTC CAGGGATACT TGGCCATGCA 
0241 CGGAGCGTAC AGGTTCTTGG GATGCTCTTT GATACCCTGG AAAATCGAGC CTGTGGCCGA 
0301 ACTCAATCTG CAGATTGTCC TTTCTGGAGT GGTGTTCATC CTGCTGCCGG TCTTTTTTAC 
0361 CTCTGCCGTA TTTAAGGTCG GCAACTTGGC AAACGACGGA ATTAAATTGN GCCACAGGTG 
0421 CCAGGGAgCG GCGCTGTACC TTATCGCCGC ACGATGGCCT GGAGGAGGAA TCACGTGGCG 
0481 GCACCCTTCG AGCCCTTTGG AC 
 in silico PCR Fragment
0001 AGCCTCAACT CCAGCCTCTG CAATTCCGTA ATGACGAACG CCACAACGGC GAGCAGCAGC 
0061 CTCACGCAAC AGCAGCAGCA GCTCCAGGCC AAGTACATCA AATCGAAGCG CCACCAGAGC 
0121 CGCTACACCA GCCTCCAGCA CTCCG-GCCA CGATTCCGGC AGCTATCTGC ATCTGAACTC 
0181 GCTATGGTCG ATCTGGTACG GAGTGATGCT CACCCTGTTC CAGGGATACT TGGCCATGCA 
0241 CGGAGCGTAC AGGTTCTTGG GATGCTCTTT GATACCCTGG AAAATCGAGC CTGTGGCCGA 
0301 ACTCAATCTG CAGATTGTCC TTTCTGGAGT GGTGTTCATC CTGCTGCCGG TCTTTTTTAC 
0361 CTCTGCCGTA TTTAAGGTCG GCAACTTGGC AAACGACGGA ATTAAATTG- GCCACAGGTG 
0421 CCAGGGAGCG GCGCTGTACC TTATCGCCGC ACGATGGCCT GGAGGAGGAA TCACGTGGCG 
0481 GCACCCTTCG AGCCCTTTGG AC 
 Assemble Data

7723R-3.IR_full       1   AGCCTCAACTCCAGCCTCTGCAATTCCGTAATGACGAACGCCACAACGGCGAGCAGCAGC 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7723R-3.in silico     1   AGCCTCAACTCCAGCCTCTGCAATTCCGTAATGACGAACGCCACAACGGCGAGCAGCAGC 60


7723R-3.IR_full       61  CTCACGCAACAGCAGCAGCAGCTCCAGGCCAAGTACATCAAATCGAAGCGCCACCAGAGC 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7723R-3.in silico     61  CTCACGCAACAGCAGCAGCAGCTCCAGGCCAAGTACATCAAATCGAAGCGCCACCAGAGC 120


7723R-3.IR_full       121 CGCTACACCAGCCTCCAGCACTCCGCGCCACGATTCCGGCAGCTATCTGCATCTGAACTC 180
                          ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||
7723R-3.in silico     121 CGCTACACCAGCCTCCAGCACTCCG-GCCACGATTCCGGCAGCTATCTGCATCTGAACTC 180


7723R-3.IR_full       181 GCTATGGTCGATCTGGTACGGAGTGATGCTCACCCTGTTCCAGGGATACTTGGCCATGCA 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7723R-3.in silico     181 GCTATGGTCGATCTGGTACGGAGTGATGCTCACCCTGTTCCAGGGATACTTGGCCATGCA 240


7723R-3.IR_full       241 CGGAGCGTACAGGTTCTTGGGATGCTCTTTGATACCCTGGAAAATCGAGCCTGTGGCCGA 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7723R-3.in silico     241 CGGAGCGTACAGGTTCTTGGGATGCTCTTTGATACCCTGGAAAATCGAGCCTGTGGCCGA 300


7723R-3.IR_full       301 ACTCAATCTGCAGATTGTCCTTTCTGGAGTGGTGTTCATCCTGCTGCCGGTCTTTTTTAC 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7723R-3.in silico     301 ACTCAATCTGCAGATTGTCCTTTCTGGAGTGGTGTTCATCCTGCTGCCGGTCTTTTTTAC 360


7723R-3.IR_full       361 CTCTGCCGTATTTAAGGTCGGCAACTTGGCAAACGACGGAATTAAATTGNGCCACAGGTG 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||
7723R-3.in silico     361 CTCTGCCGTATTTAAGGTCGGCAACTTGGCAAACGACGGAATTAAATTG-GCCACAGGTG 420


7723R-3.IR_full       421 CCAGGGAGCGGCGCTGTACCTTATCGCCGCACGATGGCCTGGAGGAGGAATCACGTGGCG 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7723R-3.in silico     421 CCAGGGAGCGGCGCTGTACCTTATCGCCGCACGATGGCCTGGAGGAGGAATCACGTGGCG 480


7723R-3.IR_full       481 GCACCCTTCGAGCCCTTTGGAC 502
                          ||||||||||||||||||||||
7723R-3.in silico     481 GCACCCTTCGAGCCCTTTGGAC 502

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  21  NM_176509.1  CG31247-RA, transcript variant A (tinc), mRNA 
100   482  21  NM_176510.1  CG31247-RD, transcript variant D (tinc), mRNA 
100   482  21  NM_169780.2  CG31247-RB, transcript variant B (tinc), mRNA 
100   482  NM_176511.1  CG31247-RC, transcript variant C (tinc), mRNA 
0.41   13  61  NM_001032408.1  CG33956-RD, transcript variant D (kay), mRNA 
0.41   47  NM_140744.1  CG6064-RA (TORC), mRNA 
0.2   89  503  NM_080536.2  CG4013-RA, transcript variant A (Smr), mRNA 
0.2   89  503  NM_167334.1  CG4013-RB, transcript variant B (Smr), mRNA 
0.2   89  503  NM_167335.1  CG4013-RC, transcript variant C (Smr), mRNA 
0.2   NM_138056.1  CG30418-RA (nord), mRNA 
0.2   20  46  NM_078801.4  CG4405-RA, transcript variant A (jp), mRNA 
0.2   20  46  NM_164858.1  CG4405-RB, transcript variant B (jp), mRNA 
0.2   14  NM_136527.1  CG14755-RA (CG14755), mRNA 
0   31  114  NM_169783.1  CG31243-RB, transcript variant B (cpo), mRNA 
0   31  114  NM_169781.1  CG31243-RE, transcript variant E (cpo), mRNA 
0   31  114  NM_169782.1  CG31243-RA, transcript variant A (cpo), mRNA 
0   NM_165512.1  CG11084-RC, transcript variant C (pk), mRNA 
0   NM_165509.1  CG11084-RB, transcript variant B (pk), mRNA 
0   NM_165508.1  CG11084-RA, transcript variant A (pk), mRNA 
0   37  122  NM_135077.2  CG14023-RA (CG14023), mRNA 
0   18  NM_142349.2  CG4060-RA (CG4060), mRNA 
0   25  82  NM_080105.2  CG31243-RF, transcript variant F (cpo), mRNA 
0   17  86  NM_134474.4  CG32532-RA (CG32532), mRNA 
0   16  79  NM_079996.2  CG18024-RA (SoxN), mRNA 
0   14  26  NM_079224.3  CG10037-RA (vvl), mRNA 
0   13  NM_206153.1  CG33130-RC, transcript variant C (l(2)k07433), mRNA 
0   13  NM_176218.1  CG33130-RA, transcript variant A (l(2)k07433), mRNA 
0   13  NM_206154.1  CG33130-RB, transcript variant B (l(2)k07433), mRNA 
0   23  45  NM_078962.2  CG2368-RB, transcript variant B (psq), mRNA 
0   23  45  NM_001014519.1  CG2368-RJ, transcript variant J (psq), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.