National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 7654R-1 
 Symbol Tom20  Full Name Translocase of outer membrane 20 
 CG No CG7654  Old CG No CG7654 
 Synonyms CG7654, dtom20, anon-WO0118547.225, Tom20 
 Accession No (Link to NCBI) NM_140912.2 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Lindstr├Âm R, Lindholm P, Palgi M, Saarma M, Heino TI.
In vivo screening reveals interactions between Drosophila Manf and genes involved in the mitochondria and the ubiquinone synthesis pathway.
BMC Genet (2017) 18(1) 52 [ PubMed ID = 28578657 ] [ RRC reference ]

Ohhara Y, Nakamura A, Kato Y, Yamakawa-Kobayashi K.
Chaperonin TRiC/CCT supports mitotic exit and entry into endocycle in Drosophila.
PLoS Genet (2019) 15(4) e1008121 [ PubMed ID = 31034473 ] [ RRC reference ]

Saj A, Arziman Z, Stempfle D, van Belle W, Sauder U, Horn T, D├╝rrenberger M, Paro R, Boutros M, Merdes G.
A combined ex vivo and in vivo RNAi screen for notch regulators in Drosophila reveals an extensive notch interaction network.
Dev Cell (2010) 18(5) 862-76 [ PubMed ID = 20493818 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgCTGCAATCGGCATTGCAGCGG 
 Primer Seq. 3'
aatctagaggtaccTTCGAGGTCGTCGATACTTGC 
 Predicted Fragment Size
494 
 IR fragment full Seq
0001 CTGCAATCGG CATTGCAGCG GTGAGTAGCT GGAACTCTGT TTATTGGATA CTGCATCTAC 
0061 TTCGACAAGA AGCGCCGCAG CGATCCCGAG TACAAGAAGA AAGTCCGTGA GCGTCGCCGT 
0121 CGCAACAAGA AAACCGGCAC TGCCAAGTCT GGAGTTCCCA ATCTGAACGA CCATGAAGCC 
0181 ATCGAAAGAT ATTTCCTTCA AGAAATCCAG CTGGGCGAGA CCCTGATCGC CCGCGGAGAT 
0241 TTCGAGAGTG GCGTGGAGCA CTTGGCGAAT GCCATCGTCG TGTGTGGCCA GCCGGCTCGT 
0301 CTGCTGCAGG TGCTGCAATC CTCCCTTCCA GCTCAAGTAT TCGCGATGCT GATCGTCAAG 
0361 ATGCAGGAGT TCGGCAATCG AGCGGCCGAG GGCAACGACG GGCCAATCGT TTTGGGGCAG 
0421 AGCTCGGAGC AACAACTGGA CGGAGCCAAA ATTATAGAGT GTTCATCTGG AAACGCAAGT 
0481 ATCGACGACC TCGAA 
 in silico PCR Fragment
0001 CTGCAATCGG CATTGCAGCG G-GAGTAGCT GGAACTCTGT TTATTGGATA CTGCATCTAC 
0061 TTCGACAAGA AGCGCCGCAG CGATCCCGAG TACAAGAAGA AAGTCCGTGA GCGTCGCCGT 
0121 CGCAACAAGA AAACCGGCAC TGCCAAGTCT GGAGTTCCCA ATCTGAACGA CCATGAAGCC 
0181 ATCGAAAGAT ATTTCCTTCA AGAAATCCAG CTGGGCGAGA CCCTGATCGC CCGCGGAGAT 
0241 TTCGAGAGTG GCGTGGAGCA CTTGGCGAAT GCCATCGTCG TGTGTGGCCA GCCGGCTCGT 
0301 CTGCTGCAGG TGCTGCAATC CTCCCTTCCA GCTCAAGTAT TCGCGATGCT GATCGTCAAG 
0361 ATGCAGGAGT TCGGCAATCG AGCGGCCGAG GGCAACGACG GGCCAATCGT TTTGGGGCAG 
0421 AGCTCGGAGC AACAACTGGA CGGAGCCAAA ATTATAGAGT GTTCATCTGG AAACGCAAGT 
0481 ATCGACGACC TCGAA 
 Assemble Data

7654R-1.IR_full       1   CTGCAATCGGCATTGCAGCGGTGAGTAGCTGGAACTCTGTTTATTGGATACTGCATCTAC 60
                          ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||
7654R-1.in silico     1   CTGCAATCGGCATTGCAGCGG-GAGTAGCTGGAACTCTGTTTATTGGATACTGCATCTAC 60


7654R-1.IR_full       61  TTCGACAAGAAGCGCCGCAGCGATCCCGAGTACAAGAAGAAAGTCCGTGAGCGTCGCCGT 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7654R-1.in silico     61  TTCGACAAGAAGCGCCGCAGCGATCCCGAGTACAAGAAGAAAGTCCGTGAGCGTCGCCGT 120


7654R-1.IR_full       121 CGCAACAAGAAAACCGGCACTGCCAAGTCTGGAGTTCCCAATCTGAACGACCATGAAGCC 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7654R-1.in silico     121 CGCAACAAGAAAACCGGCACTGCCAAGTCTGGAGTTCCCAATCTGAACGACCATGAAGCC 180


7654R-1.IR_full       181 ATCGAAAGATATTTCCTTCAAGAAATCCAGCTGGGCGAGACCCTGATCGCCCGCGGAGAT 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7654R-1.in silico     181 ATCGAAAGATATTTCCTTCAAGAAATCCAGCTGGGCGAGACCCTGATCGCCCGCGGAGAT 240


7654R-1.IR_full       241 TTCGAGAGTGGCGTGGAGCACTTGGCGAATGCCATCGTCGTGTGTGGCCAGCCGGCTCGT 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7654R-1.in silico     241 TTCGAGAGTGGCGTGGAGCACTTGGCGAATGCCATCGTCGTGTGTGGCCAGCCGGCTCGT 300


7654R-1.IR_full       301 CTGCTGCAGGTGCTGCAATCCTCCCTTCCAGCTCAAGTATTCGCGATGCTGATCGTCAAG 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7654R-1.in silico     301 CTGCTGCAGGTGCTGCAATCCTCCCTTCCAGCTCAAGTATTCGCGATGCTGATCGTCAAG 360


7654R-1.IR_full       361 ATGCAGGAGTTCGGCAATCGAGCGGCCGAGGGCAACGACGGGCCAATCGTTTTGGGGCAG 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7654R-1.in silico     361 ATGCAGGAGTTCGGCAATCGAGCGGCCGAGGGCAACGACGGGCCAATCGTTTTGGGGCAG 420


7654R-1.IR_full       421 AGCTCGGAGCAACAACTGGACGGAGCCAAAATTATAGAGTGTTCATCTGGAAACGCAAGT 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7654R-1.in silico     421 AGCTCGGAGCAACAACTGGACGGAGCCAAAATTATAGAGTGTTCATCTGGAAACGCAAGT 480


7654R-1.IR_full       481 ATCGACGACCTCGAA 495
                          |||||||||||||||
7654R-1.in silico     481 ATCGACGACCTCGAA 495

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   476  NM_140912.2  CG7654-RA (Tom20), mRNA 
0   NM_166170.1  CG7997-RB, transcript variant B (CG7997), mRNA 
0   NM_137275.2  CG7997-RA, transcript variant A (CG7997), mRNA 
0   NM_136591.3  CG8213-RA (CG8213), mRNA 
0   NM_132647.1  CG8213-RA (CG8213), mRNA,4,5-triphosphate kinase 2 CG1630-RA, transcript variant A (IP3K2), mRNA 
0   NM_167358.1  CG8213-RA (CG8213), mRNA,4,5-triphosphate kinase 2 CG1630-RA, transcript variant A (IP3K2), mRNA,4,5-triphosphate kinase 2 CG1630-RB, transcript variant B (IP3K2), mRNA 
0   NM_138052.2  CG3356-RA (CG3356), mRNA 
0   NM_169177.1  CG2507-RB, transcript variant B (sas), mRNA 
0   NM_168382.1  CG6721-RB, transcript variant B (Gap1), mRNA 
0   NM_079290.2  CG6721-RA, transcript variant A (Gap1), mRNA 
0   NM_176194.1  CG8445-RB, transcript variant B (CG8445), mRNA 
0   NM_137252.2  CG8445-RA, transcript variant A (CG8445), mRNA 
0   19  NM_001032051.1  CG33715-RD, transcript variant D (Msp-300), mRNA 
0   17  NM_001032053.1  CG33715-RB, transcript variant B (Msp-300), mRNA 
0   NM_132208.1  CG2254-RA (CG2254), mRNA 
0   NM_140378.2  CG14112-RA (SNCF), mRNA 
0   NM_168744.1  CG32183-RB, transcript variant B (Ccn), mRNA 
0   NM_168745.1  CG32183-RA, transcript variant A (Ccn), mRNA 
0   NM_079127.2  CG3691-RB, transcript variant B (Pof), mRNA 
0   NM_166682.1  CG3691-RA, transcript variant A (Pof), mRNA 
0   NM_176327.1  CG8865-RD, transcript variant D (Rgl), mRNA 
0   NM_176326.1  CG8865-RC, transcript variant C (Rgl), mRNA 
0   NM_079958.2  CG8865-RA, transcript variant A (Rgl), mRNA 
0   NM_176325.1  CG8865-RB, transcript variant B (Rgl), mRNA 
0   NM_166415.1  CG3216-RB, transcript variant B (CG3216), mRNA 
0   NM_137688.1  CG3216-RA, transcript variant A (CG3216), mRNA 
0   NM_138129.2  CG16896-RA (CG16896), mRNA 
0   NM_057876.3  CG9741-RA, transcript variant A (Dhod), mRNA 
0   NM_169230.1  CG9741-RB, transcript variant B (Dhod), mRNA 
0   NM_134311.2  CG9741-RC, transcript variant C (Dhod), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.