National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 7604R-2 
 Symbol Eig71Ee  Full Name Ecdysone-induced gene 71Ee 
 CG No CG7604  Old CG No CG7604 
 Synonyms eig71Ee, I71-7, gp150, CG7604, L71, VII, gene VII, gene-VII, L71-7, Eig71Ee 
 Accession No (Link to NCBI) NM_079368.2 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
[Please submit your publication]
Korayem AM, Fabbri M, Takahashi K, Scherfer C, Lindgren M, Schmidt O, Ueda R, Dushay MS, Theopold U.
A Drosophila salivary gland mucin is also expressed in immune tissues: evidence for a function in coagulation and the entrapment of bacteria.
Insect Biochem. Mol. Biol. (2004) 34(12) 1297-304 [ PubMed ID = 15544943 ] [ RRC reference ]

Tiwari P, Kumar A, Das RN, Malhotra V, VijayRaghavan K.
A Tendon Cell Specific RNAi Screen Reveals Novel Candidates Essential for Muscle Tendon Interaction.
PLoS ONE (2015) 10(10) e0140976 [ PubMed ID = 26488612 ] [ RRC reference ]  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                          ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| silico     1   CTAACTGTGGTCTGCTTAGTGGTAAGCTTCTTTCTGCTGCACTATGCAGAGCACAGTGAT 60

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     61  GCCTGCTTGGAGGTAATTGAGAAAGCGTTGGGTCTCCAACCGTGCAATGAAGGTGGTCGC 120

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     121 AACGAACACAGGGAGCCTCACAGGGGTGGACCAGGACCTGTGAGATCTACTAGGAGGCGC 180

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     181 GGGAGAATCCCTAGGAGACGTGAGACACCAAGACCAATACATCACAATACCAGAGAACGG 240

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     241 AGGCATCACACAAAAACAAGGAAGCCTAGAAAACCCGTTCCTTGTATTACGAAGAGGACG 300

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     301 GAACCTCCACCGGTTACAGATTTTACTACTCGAAAATCCAATCCACCATGCACTTGTACT 360

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     361 GAAAGCACTACTCGAAAGACAAATCCGACTTGTACTTGTACGGAAAGCACTACGAAAAAG 420

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     421 ACAAATCCGACTTGTACTTGTACTGAAAGCACTACTCGAAAGACAAACCCGACTTGTACT 480

7604R-2.IR_full       481 TGTACAGAGAGCACTACTCC 500
                          |||||||||||||||||||| silico     481 TGTACAGAGAGCACTACTCC 500

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
138.38  667  280  217  175  NM_079368.2  CG7604-RA (Eig71Ee), mRNA 
0   NM_143027.2  CG5805-RA (CG5805), mRNA 
0   NM_170306.1  CG31077-RA (CG31077), mRNA 
0   NM_167012.1  CG7035-RA, transcript variant A (Cbp80), mRNA 
0   NM_080011.2  CG7035-RB, transcript variant B (Cbp80), mRNA 
0   12  NM_137074.1  CG6704-RA (CG6704), mRNA 
0   NM_057346.3  CG3258-RA (ase), mRNA 
0   NM_136869.2  CG13183-RA (CG13183), mRNA 
0   NM_078554.2  CG16944-RA, transcript variant A (sesB), mRNA 
0   NM_167246.1  CG16944-RC, transcript variant C (sesB), mRNA 
0   NM_167248.1  CG16944-RB, transcript variant B (sesB), mRNA 
0   NM_167247.1  CG16944-RD, transcript variant D (sesB), mRNA 
0   15  NM_079712.2  CG18402-RA (InR), mRNA 
0   NM_001042986.1  CG17704-RF, transcript variant F (Nipped-B), mRNA 
0   NM_001042987.1  CG17704-RE, transcript variant E (Nipped-B), mRNA 
0   NM_139493.2  CG2083-RA (CG2083), mRNA 
0   NM_136889.2  CG8878-RA, transcript variant A (CG8878), mRNA 
0   NM_139943.1  CG7201-RA (CG7201), mRNA 
0   NM_206099.1  CG8878-RB, transcript variant B (CG8878), mRNA 
0   NM_205902.1  CG3304-RB, transcript variant B (CG3304), mRNA 
0   NM_134926.2  CG3304-RA, transcript variant A (CG3304), mRNA 
0   NM_205901.1  CG3304-RC, transcript variant C (CG3304), mRNA 
0   NM_078751.3  CG3047-RA (Sgs1), mRNA 
0   NM_206772.1  CG5172-RB, transcript variant B (CG5172), mRNA 
0   NM_170661.1  CG32508-RB, transcript variant B (shakB), mRNA 
0   NM_170660.1  CG32508-RA, transcript variant A (shakB), mRNA 
0   NM_132976.1  CG5172-RA, transcript variant A (CG5172), mRNA 
0   NM_140031.1  CG4821-RA, transcript variant A (Tequila), mRNA 
0   NM_206524.1  CG17269-RA (Fancd2), mRNA 
0   NM_134821.1  CG4271-RA (CG4271), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.