National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 7604R-1 
 Symbol Eig71Ee  Full Name Ecdysone-induced gene 71Ee 
 CG No CG7604  Old CG No CG7604 
 Synonyms eig71Ee, I71-7, gp150, CG7604, L71, VII, gene VII, gene-VII, L71-7, Eig71Ee 
 Accession No (Link to NCBI) NM_079368.2 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
Korayem AM, Fabbri M, Takahashi K, Scherfer C, Lindgren M, Schmidt O, Ueda R, Dushay MS, Theopold U.
A Drosophila salivary gland mucin is also expressed in immune tissues: evidence for a function in coagulation and the entrapment of bacteria.
Insect Biochem. Mol. Biol. (2004) 34(12) 1297-304 [ PubMed ID = 15544943 ] [ RRC reference ]

Umemori M, Habara O, Iwata T, Maeda K, Nishinoue K, Okabe A, Takemura M, Takahashi K, Saigo K, Ueda R, Adachi-Yamada T.
RNAi-mediated knockdown showing impaired cell survival in Drosophila wing imaginal disc.
Gene Regul Syst Bio (2009) 3 11-20 [ PubMed ID = 19838331 ] [ RRC reference ]

Tiwari P, Kumar A, Das RN, Malhotra V, VijayRaghavan K.
A Tendon Cell Specific RNAi Screen Reveals Novel Candidates Essential for Muscle Tendon Interaction.
PLoS ONE (2015) 10(10) e0140976 [ PubMed ID = 26488612 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgCTAACTGTGGTCTGCTTAGTG 
 Primer Seq. 3'
aatctagaggtaccGGAGTAGTGCTCTCTGTACAA 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 CTAACTGTGG TCTGCTTAGT GGTAAGCTTC TTTCTGCTGC ACTATGCNGA GCACAGTGAT 
0061 GCCTGCTTGG AGGTAATTGA GAAAGCGTTG GGTCTCCAAC CGTGCAATGA AGGTGGTCGC 
0121 AACGAACACA GGGAGCCTCA CAGGGGTGGA CCAGGACCTG TGAGATCTAC TAGGAGGCGC 
0181 GGGAGAATCC CTAGGAGACG TGAGACACCA AGACCAATAC ATCACAATAC CAGAGAACGG 
0241 AGGCATCACA CAAAAACAAG GAAGCCTAGA AAACCCGTTC CTTGTATTAC GAAGAGGACG 
0301 GAACCTCCAC CGGTTACAGA TTTTACTACT CGAAAATCCA ATCCACCATG CACTTGTACT 
0361 GAAAGCACTA CTCGAAAGAC AAATCCGACT TGTACTTGTA CGGAAAGCAC TACGAAAAAG 
0421 ACAAATCCGA CTTGTACTTG TACTGAAAGC ACTACTCGAA AGACAAACCC GACTTGTACT 
0481 TGTACAGAGA GCACTACTCC  
 in silico PCR Fragment
0001 CTAACTGTGG TCTGCTTAGT GGTAAGCTTC TTTCTGCTGC ACTATGCAGA GCACAGTGAT 
0061 GCCTGCTTGG AGGTAATTGA GAAAGCGTTG GGTCTCCAAC CGTGCAATGA AGGTGGTCGC 
0121 AACGAACACA GGGAGCCTCA CAGGGGTGGA CCAGGACCTG TGAGATCTAC TAGGAGGCGC 
0181 GGGAGAATCC CTAGGAGACG TGAGACACCA AGACCAATAC ATCACAATAC CAGAGAACGG 
0241 AGGCATCACA CAAAAACAAG GAAGCCTAGA AAACCCGTTC CTTGTATTAC GAAGAGGACG 
0301 GAACCTCCAC CGGTTACAGA TTTTACTACT CGAAAATCCA ATCCACCATG CACTTGTACT 
0361 GAAAGCACTA CTCGAAAGAC AAATCCGACT TGTACTTGTA CGGAAAGCAC TACGAAAAAG 
0421 ACAAATCCGA CTTGTACTTG TACTGAAAGC ACTACTCGAA AGACAAACCC GACTTGTACT 
0481 TGTACAGAGA GCACTACTCC  
 Assemble Data

7604R-1.IR_full       1   CTAACTGTGGTCTGCTTAGTGGTAAGCTTCTTTCTGCTGCACTATGCNGAGCACAGTGAT 60
                          ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||
7604R-1.in silico     1   CTAACTGTGGTCTGCTTAGTGGTAAGCTTCTTTCTGCTGCACTATGCAGAGCACAGTGAT 60


7604R-1.IR_full       61  GCCTGCTTGGAGGTAATTGAGAAAGCGTTGGGTCTCCAACCGTGCAATGAAGGTGGTCGC 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7604R-1.in silico     61  GCCTGCTTGGAGGTAATTGAGAAAGCGTTGGGTCTCCAACCGTGCAATGAAGGTGGTCGC 120


7604R-1.IR_full       121 AACGAACACAGGGAGCCTCACAGGGGTGGACCAGGACCTGTGAGATCTACTAGGAGGCGC 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7604R-1.in silico     121 AACGAACACAGGGAGCCTCACAGGGGTGGACCAGGACCTGTGAGATCTACTAGGAGGCGC 180


7604R-1.IR_full       181 GGGAGAATCCCTAGGAGACGTGAGACACCAAGACCAATACATCACAATACCAGAGAACGG 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7604R-1.in silico     181 GGGAGAATCCCTAGGAGACGTGAGACACCAAGACCAATACATCACAATACCAGAGAACGG 240


7604R-1.IR_full       241 AGGCATCACACAAAAACAAGGAAGCCTAGAAAACCCGTTCCTTGTATTACGAAGAGGACG 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7604R-1.in silico     241 AGGCATCACACAAAAACAAGGAAGCCTAGAAAACCCGTTCCTTGTATTACGAAGAGGACG 300


7604R-1.IR_full       301 GAACCTCCACCGGTTACAGATTTTACTACTCGAAAATCCAATCCACCATGCACTTGTACT 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7604R-1.in silico     301 GAACCTCCACCGGTTACAGATTTTACTACTCGAAAATCCAATCCACCATGCACTTGTACT 360


7604R-1.IR_full       361 GAAAGCACTACTCGAAAGACAAATCCGACTTGTACTTGTACGGAAAGCACTACGAAAAAG 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7604R-1.in silico     361 GAAAGCACTACTCGAAAGACAAATCCGACTTGTACTTGTACGGAAAGCACTACGAAAAAG 420


7604R-1.IR_full       421 ACAAATCCGACTTGTACTTGTACTGAAAGCACTACTCGAAAGACAAACCCGACTTGTACT 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7604R-1.in silico     421 ACAAATCCGACTTGTACTTGTACTGAAAGCACTACTCGAAAGACAAACCCGACTTGTACT 480


7604R-1.IR_full       481 TGTACAGAGAGCACTACTCC 500
                          ||||||||||||||||||||
7604R-1.in silico     481 TGTACAGAGAGCACTACTCC 500

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
138.38  667  280  217  175  NM_079368.2  CG7604-RA (Eig71Ee), mRNA 
0   NM_143027.2  CG5805-RA (CG5805), mRNA 
0   NM_170306.1  CG31077-RA (CG31077), mRNA 
0   NM_167012.1  CG7035-RA, transcript variant A (Cbp80), mRNA 
0   NM_080011.2  CG7035-RB, transcript variant B (Cbp80), mRNA 
0   12  NM_137074.1  CG6704-RA (CG6704), mRNA 
0   NM_057346.3  CG3258-RA (ase), mRNA 
0   NM_136869.2  CG13183-RA (CG13183), mRNA 
0   NM_078554.2  CG16944-RA, transcript variant A (sesB), mRNA 
0   NM_167246.1  CG16944-RC, transcript variant C (sesB), mRNA 
0   NM_167248.1  CG16944-RB, transcript variant B (sesB), mRNA 
0   NM_167247.1  CG16944-RD, transcript variant D (sesB), mRNA 
0   15  NM_079712.2  CG18402-RA (InR), mRNA 
0   NM_001042986.1  CG17704-RF, transcript variant F (Nipped-B), mRNA 
0   NM_001042987.1  CG17704-RE, transcript variant E (Nipped-B), mRNA 
0   NM_139493.2  CG2083-RA (CG2083), mRNA 
0   NM_136889.2  CG8878-RA, transcript variant A (CG8878), mRNA 
0   NM_139943.1  CG7201-RA (CG7201), mRNA 
0   NM_206099.1  CG8878-RB, transcript variant B (CG8878), mRNA 
0   NM_205902.1  CG3304-RB, transcript variant B (CG3304), mRNA 
0   NM_134926.2  CG3304-RA, transcript variant A (CG3304), mRNA 
0   NM_205901.1  CG3304-RC, transcript variant C (CG3304), mRNA 
0   NM_078751.3  CG3047-RA (Sgs1), mRNA 
0   NM_206772.1  CG5172-RB, transcript variant B (CG5172), mRNA 
0   NM_170661.1  CG32508-RB, transcript variant B (shakB), mRNA 
0   NM_170660.1  CG32508-RA, transcript variant A (shakB), mRNA 
0   NM_132976.1  CG5172-RA, transcript variant A (CG5172), mRNA 
0   NM_140031.1  CG4821-RA, transcript variant A (Tequila), mRNA 
0   NM_206524.1  CG17269-RA (Fancd2), mRNA 
0   NM_134821.1  CG4271-RA (CG4271), mRNA 
 Wing Disc
GFP
Puc
Caspase
DAPI
Merge
Figure
JNK signal
N
 
DB
++ 
DC
++ 
DM
++ 
VM
 
VB
 
Caspase-3 signal
N
DB
++ 
DC
++ 
DM
++ 
VM
++ 
VB
++ 
Dcompartment   Penetrance
     

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.