National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 7563R-3 
 Symbol CalpA  Full Name Calpain-A 
 CG No CG7563  Old CG No CG7563 
 Synonyms CG7563, EST C, CG18152, CalpA, Calpain-A, calpain, Calpain lacking calmodulin-like domain., Calpain, Calpain A 
 Accession No (Link to NCBI) NM_057700.3 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
Lee J, Cabrera AJH, Nguyen CMT, Kwon YV.
Dissemination of RasV12-transformed cells requires the mechanosensitive channel Piezo.
Nat Commun (2020) 11(1) 3568 [ PubMed ID = 32678085 ] [ RRC reference ]

Park SH, Lee CW, Lee JH, Park JY, Roshandell M, Brennan CA, Choe KM.
Requirement for and polarized localization of integrin proteins during Drosophila wound closure.
Mol. Biol. Cell (2018) 29(18) 2137-2147 [ PubMed ID = 29995573 ] [ RRC reference ]

Umemori M, Habara O, Iwata T, Maeda K, Nishinoue K, Okabe A, Takemura M, Takahashi K, Saigo K, Ueda R, Adachi-Yamada T.
RNAi-mediated knockdown showing impaired cell survival in Drosophila wing imaginal disc.
Gene Regul Syst Bio (2009) 3 11-20 [ PubMed ID = 19838331 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgAGAGGGTTCTGCCCAGCATCA 
 Primer Seq. 3'
aatctagaggtaccCTCGTTCTTCTCCGTGGAGTG 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 aGAGAGGTTC TGCCCAGCAT CAAGAATATG AGAGTTCTGG GAGAGAAGAG CTCGAGCCTG 
0061 GGACCCTATT CCGAGGTGCA GGACTATGAG ACAATATTGA ACAGCTGCCT GGCCAGTGGT 
0121 TCCCTTTTCG AAGATCCACT TTTTCCGGCT TCGAACGAGT CTCTTCAGTT TTCCCGGCGT 
0181 CCAGATCGTC ACATCGAATG GCTGAGACCT CATGAAATTG CCGAGAATCC CCAGTTTTTT 
0241 GTGGAGGGTT ATTCGCGTTT TGATGTTCAG CAAGGCGANG CTTGGTGACT GTTGGCTNCT 
0301 TGGCTGCCAC AGCCAATTTA ACTCAGGAAT CCAACCTTTT CTTTCGGGTA ATTCCAGCGG 
0361 AACAGAGTTT CGAGGAGAAC TATGCTGGTA TCTTCCATTT CCGCTTTTGG CAGTATGGTA 
0421 AATGGGTTGA TGTAATCATT GATGACCGTT TGCCCACTTA TAATGGAGAG CTGATGTACA 
0481 TGCACTCCAC GGAGAAGAAC GAG 
 in silico PCR Fragment
0001 AGAG-GGTTC TGCCCAGCAT CAAGAATATG AGAGTTCTGG GAGAGAAGAG CTCGAGCCTG 
0061 GGACCCTATT CCGAGGTGCA GGACTATGAG ACAATATTGA ACAGCTGCCT GGCCAGTGGT 
0121 TCCCTTTTCG AAGATCCACT TTTTCCGGCT TCGAACGAGT CTCTTCAGTT TTCCCGGCGT 
0181 CCAGATCGTC ACATCGAATG GCTGAGACCT CATGAAATTG CCGAGAATCC CCAGTTTTTT 
0241 GTGGAGGGTT ATTCGCGTTT TGATGTTCAG CAAGGCGA-G CTTGGTGACT GTTGGCT-CT 
0301 TGGCTGCCAC AGCCAATTTA ACTCAGGAAT CCAACCTTTT CTTTCGGGTA ATTCCAGCGG 
0361 AACAGAGTTT CGAGGAGAAC TATGCTGGTA TCTTCCATTT CCGCTTTTGG CAGTATGGTA 
0421 AATGGGTTGA TGTAATCATT GATGACCGTT TGCCCACTTA TAATGGAGAG CTGATGTACA 
0481 TGCACTCCAC GGAGAAGAAC GAG 
 Assemble Data

7563R-3.IR_full       1   AGAGAGGTTCTGCCCAGCATCAAGAATATGAGAGTTCTGGGAGAGAAGAGCTCGAGCCTG 60
                          |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||
7563R-3.in silico     1   AGAG-GGTTCTGCCCAGCATCAAGAATATGAGAGTTCTGGGAGAGAAGAGCTCGAGCCTG 60


7563R-3.IR_full       61  GGACCCTATTCCGAGGTGCAGGACTATGAGACAATATTGAACAGCTGCCTGGCCAGTGGT 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7563R-3.in silico     61  GGACCCTATTCCGAGGTGCAGGACTATGAGACAATATTGAACAGCTGCCTGGCCAGTGGT 120


7563R-3.IR_full       121 TCCCTTTTCGAAGATCCACTTTTTCCGGCTTCGAACGAGTCTCTTCAGTTTTCCCGGCGT 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7563R-3.in silico     121 TCCCTTTTCGAAGATCCACTTTTTCCGGCTTCGAACGAGTCTCTTCAGTTTTCCCGGCGT 180


7563R-3.IR_full       181 CCAGATCGTCACATCGAATGGCTGAGACCTCATGAAATTGCCGAGAATCCCCAGTTTTTT 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7563R-3.in silico     181 CCAGATCGTCACATCGAATGGCTGAGACCTCATGAAATTGCCGAGAATCCCCAGTTTTTT 240


7563R-3.IR_full       241 GTGGAGGGTTATTCGCGTTTTGATGTTCAGCAAGGCGANGCTTGGTGACTGTTGGCTNCT 300
                          |||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||
7563R-3.in silico     241 GTGGAGGGTTATTCGCGTTTTGATGTTCAGCAAGGCGA-GCTTGGTGACTGTTGGCT-CT 300


7563R-3.IR_full       301 TGGCTGCCACAGCCAATTTAACTCAGGAATCCAACCTTTTCTTTCGGGTAATTCCAGCGG 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7563R-3.in silico     301 TGGCTGCCACAGCCAATTTAACTCAGGAATCCAACCTTTTCTTTCGGGTAATTCCAGCGG 360


7563R-3.IR_full       361 AACAGAGTTTCGAGGAGAACTATGCTGGTATCTTCCATTTCCGCTTTTGGCAGTATGGTA 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7563R-3.in silico     361 AACAGAGTTTCGAGGAGAACTATGCTGGTATCTTCCATTTCCGCTTTTGGCAGTATGGTA 420


7563R-3.IR_full       421 AATGGGTTGATGTAATCATTGATGACCGTTTGCCCACTTATAATGGAGAGCTGATGTACA 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7563R-3.in silico     421 AATGGGTTGATGTAATCATTGATGACCGTTTGCCCACTTATAATGGAGAGCTGATGTACA 480


7563R-3.IR_full       481 TGCACTCCACGGAGAAGAACGAG 503
                          |||||||||||||||||||||||
7563R-3.in silico     481 TGCACTCCACGGAGAAGAACGAG 503

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_057699.3  CG7563-RB, transcript variant B (CalpA), mRNA 
100   482  NM_057700.3  CG7563-RA, transcript variant A (CalpA), mRNA 
1.86   31  41  NM_079292.4  CG8107-RA (CalpB), mRNA 
0   NM_001014652.1  CG10693-RP, transcript variant P (slo), mRNA 
0   NM_001014651.1  CG10693-RQ, transcript variant Q (slo), mRNA 
0   NM_001014663.1  CG10693-RE, transcript variant E (slo), mRNA 
0   NM_001014664.1  CG10693-RD, transcript variant D (slo), mRNA 
0   NM_001014653.1  CG10693-RO, transcript variant O (slo), mRNA 
0   NM_001014660.1  CG10693-RH, transcript variant H (slo), mRNA 
0   NM_001014658.1  CG10693-RJ, transcript variant J (slo), mRNA 
0   NM_001014659.1  CG10693-RI, transcript variant I (slo), mRNA 
0   NM_001014656.1  CG10693-RL, transcript variant L (slo), mRNA 
0   NM_001014657.1  CG10693-RK, transcript variant K (slo), mRNA 
0   NM_079762.2  CG10693-RA, transcript variant A (slo), mRNA 
0   NM_001014661.1  CG10693-RG, transcript variant G (slo), mRNA 
0   NM_001014655.1  CG10693-RM, transcript variant M (slo), mRNA 
0   NM_001014654.1  CG10693-RN, transcript variant N (slo), mRNA 
0   NM_001014662.1  CG10693-RF, transcript variant F (slo), mRNA 
0   NM_206566.1  CG10693-RC, transcript variant C (slo), mRNA 
0   NM_170164.1  CG10693-RB, transcript variant B (slo), mRNA 
0   NM_142190.2  CG4931-RA (Sra-1), mRNA 
0   NM_167003.1  CG32775-RA (GlcAT-I), mRNA 
0   NM_057386.3  CG6137-RA (aub), mRNA 
0   NM_080307.1  CG3206-RA (Or2a), mRNA 
0   NM_169496.1  CG8141-RA (CG8141), mRNA 
0   NM_001043295.1  CG34129-RA (CG34129), mRNA 
0   NM_079383.2  CG4531-RA (argos), mRNA 
0   NM_176494.2  CG10851-RG, transcript variant G (B52), mRNA 
0   NM_176493.2  CG10851-RF, transcript variant F (B52), mRNA 
0   NM_176492.2  CG10851-RD, transcript variant D (B52), mRNA 
 Wing Disc
GFP
Puc
Caspase
DAPI
Merge
Figure
JNK signal
N
+- 
DB
DC
DM
+- 
VM
 
VB
 
Caspase-3 signal
N
DB
++ 
DC
++ 
DM
VM
 
VB
 
Dcompartment   Penetrance
     

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.