National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 7562R-2 
 Symbol Trf  Full Name TBP-related factor 
 CG No CG7562  Old CG No CG7562 
 Synonyms TRF, TRF1, X70838, dTRF1, Trf1, CG7562, trf, Trf 
 Accession No (Link to NCBI) NM_057591.3 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Nitta Y, Yamazaki D, Sugie A, Hiroi M, Tabata T.
DISCO Interacting Protein 2 regulates axonal bifurcation and guidance of Drosophila mushroom body neurons.
Dev. Biol. (2017) 421(2) 233-244 [ PubMed ID = 27908785 ] [ RRC reference ]

Tiwari P, Kumar A, Das RN, Malhotra V, VijayRaghavan K.
A Tendon Cell Specific RNAi Screen Reveals Novel Candidates Essential for Muscle Tendon Interaction.
PLoS ONE (2015) 10(10) e0140976 [ PubMed ID = 26488612 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgACTTTAAAGTCGCGGACGCTG 
 Primer Seq. 3'
aatctagaggtaccTTCGTAGGAACTAAACTGCCC 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 ACTTTAAAGT CGCGGACGCT GAAAGGGACA GGGATAATGT GGCTGCGACC AGcAATGCTG 
0061 CCGCCAATCC GCACGCAGCC CTGCAGCCGC AACAGCCCGT TGCCCTGGTG GAGCCCAAGG 
0121 ATGCACAACA TGAGATACGA TTGCAGAATA TCGTGGCCAC CTTCTCGGTG AACTGTGAAC 
0181 TGGACCTCAA GGCAATCAAC TCGCGTACGA GGAACTCGGA GTANCTCGCC CAAGCGCTTT 
0241 TCGTGGCGTC ATCATGCGAA TGCACTCGCC CAGGTGCACA GCGCTTAATC TTTCGAACGG 
0301 GCAAGGTCAT CTGCACGGGT GCACGAAACG AGATTGAGGC GGACATTGGA TCGCGAAAGT 
0361 TCGCACGCAT CCTGCAGAAG CTGGGATTCC CCGTAAAGTT CATGGAATAC AAGCTGCAGA 
0421 ATATTGTGGC CACCGTTGAT CTGCGCNTTC CCCATCCGCC NTGGAGAACC TCAACCACGT 
0481 GCACGGGCAG TTTAGTTCCT ACGAA 
 in silico PCR Fragment
0001 ACTTTAAAGT CGCGGACGCT GAAAGGGACA GGGATAATGT GGCTGCGACC AGCAATGCTG 
0061 CCGCCAATCC GCACGCAGCC CTGCAGCCGC AACAGCCCGT TGCCCTGGTG GAGCCCAAGG 
0121 ATGCACAACA TGAGATACGA TTGCAGAATA TCGTGGCCAC CTTCTCGGTG AACTGTGAAC 
0181 TGGACCTCAA GGCAATCAAC TCGCGTACGA GGAACTCGGA GTA-CTCGCC CAAGCGC-TT 
0241 TCGTGGCGTC ATCATGCGAA TGCACTCGCC CAGGTGCACA GCGC-TAATC TTTCGAACGG 
0301 GCAAGGTCAT CTGCACGGGT GCACGAAACG AGATTGAGGC GGACATTGGA TCGCGAAAGT 
0361 TCGCACGCAT CCTGCAGAAG CTGGGATTCC CCGTAAAGTT CATGGAATAC AAGCTGCAGA 
0421 ATATTGTGGC CACCGTTGAT CTGCGC-TTC CCCATCCGCC -TGGAGAACC TCAACCACGT 
0481 GCACGGGCAG TTTAGTTCCT ACGAA 
 Assemble Data

7562R-2.IR_full       1   ACTTTAAAGTCGCGGACGCTGAAAGGGACAGGGATAATGTGGCTGCGACCAGCAATGCTG 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7562R-2.in silico     1   ACTTTAAAGTCGCGGACGCTGAAAGGGACAGGGATAATGTGGCTGCGACCAGCAATGCTG 60


7562R-2.IR_full       61  CCGCCAATCCGCACGCAGCCCTGCAGCCGCAACAGCCCGTTGCCCTGGTGGAGCCCAAGG 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7562R-2.in silico     61  CCGCCAATCCGCACGCAGCCCTGCAGCCGCAACAGCCCGTTGCCCTGGTGGAGCCCAAGG 120


7562R-2.IR_full       121 ATGCACAACATGAGATACGATTGCAGAATATCGTGGCCACCTTCTCGGTGAACTGTGAAC 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7562R-2.in silico     121 ATGCACAACATGAGATACGATTGCAGAATATCGTGGCCACCTTCTCGGTGAACTGTGAAC 180


7562R-2.IR_full       181 TGGACCTCAAGGCAATCAACTCGCGTACGAGGAACTCGGAGTANCTCGCCCAAGCGCTTT 240
                          ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| ||
7562R-2.in silico     181 TGGACCTCAAGGCAATCAACTCGCGTACGAGGAACTCGGAGTA-CTCGCCCAAGCGC-TT 240


7562R-2.IR_full       241 TCGTGGCGTCATCATGCGAATGCACTCGCCCAGGTGCACAGCGCTTAATCTTTCGAACGG 300
                          |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||
7562R-2.in silico     241 TCGTGGCGTCATCATGCGAATGCACTCGCCCAGGTGCACAGCGC-TAATCTTTCGAACGG 300


7562R-2.IR_full       301 GCAAGGTCATCTGCACGGGTGCACGAAACGAGATTGAGGCGGACATTGGATCGCGAAAGT 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7562R-2.in silico     301 GCAAGGTCATCTGCACGGGTGCACGAAACGAGATTGAGGCGGACATTGGATCGCGAAAGT 360


7562R-2.IR_full       361 TCGCACGCATCCTGCAGAAGCTGGGATTCCCCGTAAAGTTCATGGAATACAAGCTGCAGA 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7562R-2.in silico     361 TCGCACGCATCCTGCAGAAGCTGGGATTCCCCGTAAAGTTCATGGAATACAAGCTGCAGA 420


7562R-2.IR_full       421 ATATTGTGGCCACCGTTGATCTGCGCNTTCCCCATCCGCCNTGGAGAACCTCAACCACGT 480
                          |||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||
7562R-2.in silico     421 ATATTGTGGCCACCGTTGATCTGCGC-TTCCCCATCCGCC-TGGAGAACCTCAACCACGT 480


7562R-2.IR_full       481 GCACGGGCAGTTTAGTTCCTACGAA 505
                          |||||||||||||||||||||||||
7562R-2.in silico     481 GCACGGGCAGTTTAGTTCCTACGAA 505

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_057591.3  CG7562-RA (Trf), mRNA 
0   NM_168563.1  CG32137-RB, transcript variant B (CG32137), mRNA 
0   NM_168564.1  CG32137-RA, transcript variant A (CG32137), mRNA 
0   NM_143320.2  CG18437-RA (CG18437), mRNA 
0   NM_167082.2  CG4095-RA (CG4095), mRNA 
0   NM_079507.2  CG2530-RA (corto), mRNA 
0   NM_167961.1  CG1244-RE, transcript variant E (CG1244), mRNA 
0   NM_078930.2  CG18654-RA, transcript variant A (Dgk), mRNA 
0   NM_165568.1  CG18654-RB, transcript variant B (Dgk), mRNA 
0   NM_167962.1  CG1244-RF, transcript variant F (CG1244), mRNA 
0   NM_167960.1  CG1244-RD, transcript variant D (CG1244), mRNA 
0   NM_167958.1  CG1244-RB, transcript variant B (CG1244), mRNA 
0   NM_139476.1  CG1244-RA, transcript variant A (CG1244), mRNA 
0   NM_167959.1  CG1244-RC, transcript variant C (CG1244), mRNA 
0   NM_142237.2  CG4606-RA (alpha-Man-IIb), mRNA 
0   NM_078645.2  CG4252-RA (mei-41), mRNA 
0   NM_170625.1  CG17034-RC, transcript variant C (CG17034), mRNA 
0   NM_170624.1  CG17034-RB, transcript variant B (CG17034), mRNA 
0   NM_165984.1  CG17034-RA, transcript variant A (CG17034), mRNA 
0   NM_137029.2  CG17034-RD, transcript variant D (CG17034), mRNA 
0   NM_165725.2  CG12134-RB, transcript variant B (CG12134), mRNA 
0   NM_143128.2  CG10562-RA (CG10562), mRNA 
0   NM_141283.2  CG12162-RA, transcript variant A (CG12162), mRNA 
0   NM_169054.1  CG12162-RB, transcript variant B (CG12162), mRNA 
0   NM_134581.1  CG1518-RA (CG1518), mRNA 
0   NM_138025.2  CG3121-RA (CG3121), mRNA 
0   NM_137794.2  CG11073-RA (CG11073), mRNA 
0   12  NM_143738.2  CG1851-RA (Ady43A), mRNA 
0   NM_168647.1  CG32156-RA, transcript variant A (Mbs), mRNA 
0   NM_168648.1  CG32156-RB, transcript variant B (Mbs), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.