National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 7562R-1 
 Symbol Trf  Full Name TBP-related factor 
 CG No CG7562  Old CG No CG7562 
 Synonyms TRF, TRF1, X70838, dTRF1, Trf1, CG7562, trf, Trf 
 Accession No (Link to NCBI) NM_057591.3 
 Inserted Chr. lll 
 Insertional Mutation  semi-lethal 
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
[Please submit your publication]
Nitta Y, Yamazaki D, Sugie A, Hiroi M, Tabata T.
DISCO Interacting Protein 2 regulates axonal bifurcation and guidance of Drosophila mushroom body neurons.
Dev. Biol. (2017) 421(2) 233-244 [ PubMed ID = 27908785 ] [ RRC reference ]

Tiwari P, Kumar A, Das RN, Malhotra V, VijayRaghavan K.
A Tendon Cell Specific RNAi Screen Reveals Novel Candidates Essential for Muscle Tendon Interaction.
PLoS ONE (2015) 10(10) e0140976 [ PubMed ID = 26488612 ] [ RRC reference ]  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     1   ACTTTAAAGTCGCGGACGCTGAAAGGGACAGGGATAATGTGGCTGCGACCAGCAATGCTG 60

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     61  CCGCCAATCCGCACGCAGCCCTGCAGCCGCAACAGCCCGTTGCCCTGGTGGAGCCCAAGG 120

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     121 ATGCACAACATGAGATACGATTGCAGAATATCGTGGCCACCTTCTCGGTGAACTGTGAAC 180

                          ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| || silico     181 TGGACCTCAAGGCAATCAACTCGCGTACGAGGAACTCGGAGTA-CTCGCCCAAGCGC-TT 240

                          |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| silico     241 TCGTGGCGTCATCATGCGAATGCACTCGCCCAGGTGCACAGCGC-TAATCTTTCGAACGG 300

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     301 GCAAGGTCATCTGCACGGGTGCACGAAACGAGATTGAGGCGGACATTGGATCGCGAAAGT 360

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     361 TCGCACGCATCCTGCAGAAGCTGGGATTCCCCGTAAAGTTCATGGAATACAAGCTGCAGA 420

                          |||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||| silico     421 ATATTGTGGCCACCGTTGATCTGCGC-TTCCCCATCCGCC-TGGAGAACCTCAACCACGT 480

                          ||||||||||||||||||||||||| silico     481 GCACGGGCAGTTTAGTTCCTACGAA 505

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_057591.3  CG7562-RA (Trf), mRNA 
0   NM_168563.1  CG32137-RB, transcript variant B (CG32137), mRNA 
0   NM_168564.1  CG32137-RA, transcript variant A (CG32137), mRNA 
0   NM_143320.2  CG18437-RA (CG18437), mRNA 
0   NM_167082.2  CG4095-RA (CG4095), mRNA 
0   NM_079507.2  CG2530-RA (corto), mRNA 
0   NM_167961.1  CG1244-RE, transcript variant E (CG1244), mRNA 
0   NM_078930.2  CG18654-RA, transcript variant A (Dgk), mRNA 
0   NM_165568.1  CG18654-RB, transcript variant B (Dgk), mRNA 
0   NM_167962.1  CG1244-RF, transcript variant F (CG1244), mRNA 
0   NM_167960.1  CG1244-RD, transcript variant D (CG1244), mRNA 
0   NM_167958.1  CG1244-RB, transcript variant B (CG1244), mRNA 
0   NM_139476.1  CG1244-RA, transcript variant A (CG1244), mRNA 
0   NM_167959.1  CG1244-RC, transcript variant C (CG1244), mRNA 
0   NM_142237.2  CG4606-RA (alpha-Man-IIb), mRNA 
0   NM_078645.2  CG4252-RA (mei-41), mRNA 
0   NM_170625.1  CG17034-RC, transcript variant C (CG17034), mRNA 
0   NM_170624.1  CG17034-RB, transcript variant B (CG17034), mRNA 
0   NM_165984.1  CG17034-RA, transcript variant A (CG17034), mRNA 
0   NM_137029.2  CG17034-RD, transcript variant D (CG17034), mRNA 
0   NM_165725.2  CG12134-RB, transcript variant B (CG12134), mRNA 
0   NM_143128.2  CG10562-RA (CG10562), mRNA 
0   NM_141283.2  CG12162-RA, transcript variant A (CG12162), mRNA 
0   NM_169054.1  CG12162-RB, transcript variant B (CG12162), mRNA 
0   NM_134581.1  CG1518-RA (CG1518), mRNA 
0   NM_138025.2  CG3121-RA (CG3121), mRNA 
0   NM_137794.2  CG11073-RA (CG11073), mRNA 
0   12  NM_143738.2  CG1851-RA (Ady43A), mRNA 
0   NM_168647.1  CG32156-RA, transcript variant A (Mbs), mRNA 
0   NM_168648.1  CG32156-RB, transcript variant B (Mbs), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.