National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 7524R-1 
 Symbol Src64B  Full Name Src oncogene at 64B 
 CG No CG7524  Old CG No CG7524 
 Synonyms Src64, Src, src64, src64B, CG7524, src64b, dSrc, DSrc64B, Dsrc64B, SRC 64B, src, DSrc64, DmHD-358, dsrc, Dsrc64, Dm SRC1, DSRC64, DSrc, Src1, Dsrc, D-src, c-src, src1, HD-358, C-src1, Src64B 
 Accession No (Link to NCBI) NM_080195.2 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Houtz P, Bonfini A, Liu X, Revah J, Guillou A, Poidevin M, Hens K, Huang HY, Deplancke B, Tsai YC, Buchon N.
Hippo, TGF-β, and Src-MAPK pathways regulate transcription of the upd3 cytokine in Drosophila enterocytes upon bacterial infection.
PLoS Genet. (2017) 13(11) e1007091 [ PubMed ID = 29108021 ] [ RRC reference ]

Fairchild MJ, Islam F, Tanentzapf G.
Identification of genetic networks that act in the somatic cells of the testis to mediate the developmental program of spermatogenesis.
PLoS Genet. (2017) 13(9) e1007026 [ PubMed ID = 28957323 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgTGCAGCAAGCGACAGGATCAG 
 Primer Seq. 3'
aatctagaggtaccGCCTCCTTTCGTAGCACATTC 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 TGCAGCaAGC GACAGGATCA GGAACTGGCA CTGGCCTATC CCACTGGGGG CTACAAGAAA 
0061 TCCGACTACA CCTTTGGCCA GACGCACATC AACAGCAGCG GCGGCGGCAA CATGGGCGGC 
0121 GTTCTTGGCC AGAAGCATAA CAACGGTGGC TCGCTGGACT CGCGCTACAC GCCCGATCCC 
0181 AATCATCGGG GTCCGTTGAA AATCGGCGGA AAGGGCGGCG TTGACATCAT CAAGACCNAC 
0241 GCANCCACAC CAACCGGTGT TCCTGGTGTC GTGCTCAAGC GCGTTGTCGT GGCCCTGTAC 
0301 GACTATAAAT CCCGCGATGA ATCCGATCTG AGCTTCATGA AGGGTGACCG CNATGGAGGT 
0361 CATCGACGAC ACCGAGTCCG ATTGGTGGCG CGTCGTGAAC CTAACCACCC GGCAGGAGGG 
0421 CCTCATCCCG CTCAATTTCG TGGCGGAGGA GCGCAGCGTG AACAGCGAAG ACTGGTTCTT 
0481 TGAGAATGTG CTACGAAAGG AGGC 
 in silico PCR Fragment
0001 TGCAGCAAGC GACAGGATCA GGAACTGGCA CTGGCCTATC CCACTGGGGG CTACAAGAAA 
0061 TCCGACTACA CCTTTGGCCA GACGCACATC AACAGCAGCG GCGGCGGCAA CATGGGCGGC 
0121 GTTCTTGGCC AGAAGCATAA CAACGGTGGC TCGCTGGACT CGCGCTACAC GCCCGATCCC 
0181 AATCATCGGG GTCCGTTGAA AATCGGCGGA AAGGGCGGCG TTGACATCAT C-AGACC-AC 
0241 GCA-CCACAC CAACCGGTGT TCCTGGTGTC GTGCTCAAGC GCGTTGTCGT GGCCCTGTAC 
0301 GACTATAAAT CCCGCGATGA ATCCGATCTG AGCTTCATGA AGGGTGACCG C-ATGGAGGT 
0361 CATCGACGAC ACCGAGTCCG ATTGGTGGCG CGTCGTGAAC CTAACCACCC GGCAGGAGGG 
0421 CCTCATCCCG CTCAATTTCG TGGCGGAGGA GCGCAGCGTG AACAGCGAAG ACTGGTTCTT 
0481 TGAGAATGTG CTACGAAAGG AGGC 
 Assemble Data

7524R-1.IR_full       1   TGCAGCAAGCGACAGGATCAGGAACTGGCACTGGCCTATCCCACTGGGGGCTACAAGAAA 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7524R-1.in silico     1   TGCAGCAAGCGACAGGATCAGGAACTGGCACTGGCCTATCCCACTGGGGGCTACAAGAAA 60


7524R-1.IR_full       61  TCCGACTACACCTTTGGCCAGACGCACATCAACAGCAGCGGCGGCGGCAACATGGGCGGC 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7524R-1.in silico     61  TCCGACTACACCTTTGGCCAGACGCACATCAACAGCAGCGGCGGCGGCAACATGGGCGGC 120


7524R-1.IR_full       121 GTTCTTGGCCAGAAGCATAACAACGGTGGCTCGCTGGACTCGCGCTACACGCCCGATCCC 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7524R-1.in silico     121 GTTCTTGGCCAGAAGCATAACAACGGTGGCTCGCTGGACTCGCGCTACACGCCCGATCCC 180


7524R-1.IR_full       181 AATCATCGGGGTCCGTTGAAAATCGGCGGAAAGGGCGGCGTTGACATCATCAAGACCNAC 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||
7524R-1.in silico     181 AATCATCGGGGTCCGTTGAAAATCGGCGGAAAGGGCGGCGTTGACATCATC-AGACC-AC 240


7524R-1.IR_full       241 GCANCCACACCAACCGGTGTTCCTGGTGTCGTGCTCAAGCGCGTTGTCGTGGCCCTGTAC 300
                          ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7524R-1.in silico     241 GCA-CCACACCAACCGGTGTTCCTGGTGTCGTGCTCAAGCGCGTTGTCGTGGCCCTGTAC 300


7524R-1.IR_full       301 GACTATAAATCCCGCGATGAATCCGATCTGAGCTTCATGAAGGGTGACCGCNATGGAGGT 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||
7524R-1.in silico     301 GACTATAAATCCCGCGATGAATCCGATCTGAGCTTCATGAAGGGTGACCGC-ATGGAGGT 360


7524R-1.IR_full       361 CATCGACGACACCGAGTCCGATTGGTGGCGCGTCGTGAACCTAACCACCCGGCAGGAGGG 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7524R-1.in silico     361 CATCGACGACACCGAGTCCGATTGGTGGCGCGTCGTGAACCTAACCACCCGGCAGGAGGG 420


7524R-1.IR_full       421 CCTCATCCCGCTCAATTTCGTGGCGGAGGAGCGCAGCGTGAACAGCGAAGACTGGTTCTT 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7524R-1.in silico     421 CCTCATCCCGCTCAATTTCGTGGCGGAGGAGCGCAGCGTGAACAGCGAAGACTGGTTCTT 480


7524R-1.IR_full       481 TGAGAATGTGCTACGAAAGGAGGC 504
                          ||||||||||||||||||||||||
7524R-1.in silico     481 TGAGAATGTGCTACGAAAGGAGGC 504

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_001014563.1  CG7524-RF, transcript variant F (Src64B), mRNA 
100   482  NM_001014562.1  CG7524-RC, transcript variant C (Src64B), mRNA 
100   482  NM_001014561.1  CG7524-RD, transcript variant D (Src64B), mRNA 
100   482  NM_080195.2  CG7524-RB, transcript variant B (Src64B), mRNA 
100   482  NM_001014564.1  CG7524-RE, transcript variant E (Src64B), mRNA 
0.82   11  NM_169961.1  CG6376-RB, transcript variant B (E2f), mRNA 
0.82   11  NM_169962.1  CG6376-RC, transcript variant C (E2f), mRNA 
0.82   11  NM_079713.2  CG6376-RA, transcript variant A (E2f), mRNA 
0.41   NM_139485.1  CG12187-RA (CG12187), mRNA 
0   26  NM_132953.1  CG13001-RA (CG13001), mRNA 
0   11  48  NM_168113.2  CG32423-RD, transcript variant D (alan-shepard), mRNA 
0   45  NM_166057.1  CG8787-RA, transcript variant A (Asx), mRNA 
0   45  NM_001014527.1  CG8787-RB, transcript variant B (Asx), mRNA 
0   27  NM_176556.1  CG33106-RA, transcript variant A (mask), mRNA 
0   25  NM_176557.1  CG33106-RB, transcript variant B (mask), mRNA 
0   11  23  NM_139503.1  CG2162-RA (CG2162), mRNA 
0   11  18  NM_167347.1  CG4353-RB, transcript variant B (hep), mRNA 
0   11  18  NM_167346.1  CG4353-RA, transcript variant A (hep), mRNA 
0   22  NM_164716.1  CG31632-RA (CG31632), mRNA 
0   39  NM_169696.1  CG3992-RA, transcript variant A (srp), mRNA 
0   38  NM_169694.1  CG3992-RB, transcript variant B (srp), mRNA 
0   18  NM_001032019.1  CG3992-RD, transcript variant D (srp), mRNA 
0   15  NM_132479.2  CG1597-RA (CG1597), mRNA 
0   11  NM_080516.1  CG16757-RA (Spn), mRNA 
0   NM_057849.3  CG3733-RA (Chd1), mRNA 
0   NM_169115.1  CG2017-RB, transcript variant B (CG2017), mRNA 
0   NM_169116.1  CG2017-RC, transcript variant C (CG2017), mRNA 
0   NM_169117.1  CG2017-RD, transcript variant D (CG2017), mRNA 
0   NM_141346.2  CG2017-RA, transcript variant A (CG2017), mRNA 
0   22  NM_168179.1  CG32394-RA (CG32394), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.