National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 7486R-1 
 Symbol Dredd  Full Name Death related ced-3/Nedd2-like protein 
 CG No CG7486  Old CG No CG7486 
 Synonyms DREDD, dredd, Dcp-2/Dredd, Dcp-2, CG7486, EG:115C2.9, DCP-2/DREDD, DCP-2, dcp-2/dredd, Dcp2, DCP2, unnamed, anon-1BCa, Redd, Dedd, Dredd 
 Accession No (Link to NCBI) NM_057903.3 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Nagata R, Nakamura M, Sanaki Y, Igaki T.
Cell Competition Is Driven by Autophagy.
Dev. Cell (2019) [ PubMed ID = 31543447 ] [ RRC reference ]

Bangi E, Pitsouli C, Rahme LG, Cagan R, Apidianakis Y.
Immune response to bacteria induces dissemination of Ras-activated Drosophila hindgut cells.
EMBO Rep. (2012) 13(6) 569-76 [ PubMed ID = 22498775 ] [ RRC reference ]

Leulier F, Ribeiro PS, Palmer E, Tenev T, Takahashi K, Robertson D, Zachariou A, Pichaud F, Ueda R, Meier P.
Systematic in vivo RNAi analysis of putative components of the Drosophila cell death machinery.
Cell Death Differ. (2006) 13(10) 1663-74 [ PubMed ID = 16485033 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgACCACTCGGATGCCACCTACA 
 Primer Seq. 3'
aatctagaggtaccTGCTTGCGCCTGCAGACCGTT 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 ACCACTCGGA TGCCACCTAC ATTCTGCAGA AACTTTTGGC CATGACACGA TCAGACTTCC 
0061 CGCAAAGTGA TCTACTCATA AAGTTCGCCA AGTCCCGGCC AGAAACCTGG AGAAGACATC 
0121 TCGTGGAGGC CCTGTGCATT ATTGGGGCCC GCAAGGTGCN TCCGGAGACT GGGTTTCTGC 
0181 TGGCAGGAGC TGCGAATGCA CTACTTGCCG CATATCGCTG GGATCACGCT GCATGTCCAT 
0241 CCTCTGTTGA AGAGCCTCTA CAGGATGTGT GAGGAGTTGT CGTTGGTGCA GAGTGGCCGC 
0301 NTTGCTCCTA GATGTTCGCG AAAAGGTGGA GAGCCAGCAG GCAGGAGATC CACTTCGCTT 
0361 CTACGATCCC GCGTACCTGG AGATCTTTTT GCTGGACTGG CTGACCAGAA GGAGCATAAA 
0421 GTTAGGGGAC ATAANATgcC GCAGGCAGCG ATGTTCAGCT GCTGGTCGGC CATTTGAAGT 
0481 CCAACGGTCT GCAGGCGCAA GCA 
 in silico PCR Fragment
0001 ACCACTCGGA TGCCACCTAC ATTCTGCAGA AACTTTTGGC CATGACACGA TCAGACTTCC 
0061 CGCAAAGTGA TCTACTCATA AAGTTCGCCA AGTCCCGGCC AGAAACCTGG AGAAGACATC 
0121 TCGTGGAGGC CCTGTGCATT ATTGGGGCCC GCAAGGTGC- TCCGGAGACT GGGTTTCTGC 
0181 TGGCAGGAGC TGCGAATGCA CTACTTGCCG CATATCGCTG GGATCACGCT GCATGTCCAT 
0241 CCTCTGTTGA AGAGCCTCTA CAGGATGTGT GAGGAGTTGT CGTTGGTGCA GAGTGGCCGC 
0301 -TTGCTCCTA GATGTTCGCG AAAAGGTGGA GAGCCAGCAG GCAGGAGATC CACTTCGCTT 
0361 CTACGATCCC GCGTACCTGG AGATCTTTTT GCTGGACTGG CTGACCAGAA GGAGCATAAA 
0421 GTTAGGGGAC ATAA-ATGCC GCAGGCAGCG ATGTTCAGCT GCTGGTCGGC CATTTGAAGT 
0481 CCAACGGTCT GCAGGCGCAA GCA 
 Assemble Data

7486R-1.IR_full       1   ACCACTCGGATGCCACCTACATTCTGCAGAAACTTTTGGCCATGACACGATCAGACTTCC 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7486R-1.in silico     1   ACCACTCGGATGCCACCTACATTCTGCAGAAACTTTTGGCCATGACACGATCAGACTTCC 60


7486R-1.IR_full       61  CGCAAAGTGATCTACTCATAAAGTTCGCCAAGTCCCGGCCAGAAACCTGGAGAAGACATC 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7486R-1.in silico     61  CGCAAAGTGATCTACTCATAAAGTTCGCCAAGTCCCGGCCAGAAACCTGGAGAAGACATC 120


7486R-1.IR_full       121 TCGTGGAGGCCCTGTGCATTATTGGGGCCCGCAAGGTGCNTCCGGAGACTGGGTTTCTGC 180
                          ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||
7486R-1.in silico     121 TCGTGGAGGCCCTGTGCATTATTGGGGCCCGCAAGGTGC-TCCGGAGACTGGGTTTCTGC 180


7486R-1.IR_full       181 TGGCAGGAGCTGCGAATGCACTACTTGCCGCATATCGCTGGGATCACGCTGCATGTCCAT 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7486R-1.in silico     181 TGGCAGGAGCTGCGAATGCACTACTTGCCGCATATCGCTGGGATCACGCTGCATGTCCAT 240


7486R-1.IR_full       241 CCTCTGTTGAAGAGCCTCTACAGGATGTGTGAGGAGTTGTCGTTGGTGCAGAGTGGCCGC 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7486R-1.in silico     241 CCTCTGTTGAAGAGCCTCTACAGGATGTGTGAGGAGTTGTCGTTGGTGCAGAGTGGCCGC 300


7486R-1.IR_full        301 TTGCTCCTAGATGTTCGCGAAAAGGTGGAGAGCCAGCAGGCAGGAGATCCACTTCGCTT 359
                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7486R-1.in silico      301 TTGCTCCTAGATGTTCGCGAAAAGGTGGAGAGCCAGCAGGCAGGAGATCCACTTCGCTT 359


7486R-1.IR_full       361 CTACGATCCCGCGTACCTGGAGATCTTTTTGCTGGACTGGCTGACCAGAAGGAGCATAAA 419
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7486R-1.in silico     361 CTACGATCCCGCGTACCTGGAGATCTTTTTGCTGGACTGGCTGACCAGAAGGAGCATAAA 419


7486R-1.IR_full       421 GTTAGGGGACATAANATGCCGCAGGCAGCGATGTTCAGCTGCTGGTCGGCCATTTGAAGT 479
                          |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||
7486R-1.in silico     421 GTTAGGGGACATAA-ATGCCGCAGGCAGCGATGTTCAGCTGCTGGTCGGCCATTTGAAGT 479


7486R-1.IR_full       481 CCAACGGTCTGCAGGCGCAAGCA 502
                          |||||||||||||||||||||||
7486R-1.in silico     481 CCAACGGTCTGCAGGCGCAAGCA 502

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_057902.3  CG7486-RC, transcript variant C (Dredd), mRNA 
100   482  NM_057901.3  CG7486-RB, transcript variant B (Dredd), mRNA 
100   482  NM_057903.3  CG7486-RA, transcript variant A (Dredd), mRNA 
0   NM_167515.1  CG4239-RA, transcript variant A (CG4239), mRNA 
0   NM_132894.2  CG4239-RC, transcript variant C (CG4239), mRNA 
0   NM_167516.1  CG4239-RB, transcript variant B (CG4239), mRNA 
0   NM_137235.2  CG8399-RA (CG8399), mRNA 
0   NM_142668.2  CG3822-RA (CG3822), mRNA 
0   NM_078935.2  CG2160-RA (Socs44A), mRNA 
0   NM_135896.3  CG4168-RA (CG4168), mRNA 
0   NM_167729.1  CG15445-RA, transcript variant A (CG15445), mRNA 
0   NM_134592.2  CG15445-RD, transcript variant D (CG15445), mRNA 
0   NM_167730.1  CG15445-RB, transcript variant B (CG15445), mRNA 
0   NM_167731.1  CG15445-RC, transcript variant C (CG15445), mRNA 
0   NM_136041.1  CG10231-RA (Pde11), mRNA 
0   NM_001043220.1  CG34127-RA (CG34127), mRNA 
0   NM_079000.2  CG3879-RA (Mdr49), mRNA 
0   NM_078872.4  CG10302-RA (bsf), mRNA 
0   133  NM_078751.3  CG3047-RA (Sgs1), mRNA 
0   NM_079223.2  CG10129-RA (ndl), mRNA 
0   NM_166606.1  CG30181-RA (CG30181), mRNA 
0   NM_136085.2  CG10650-RA (CG10650), mRNA 
0   NM_169775.1  CG7467-RA, transcript variant A (osa), mRNA 
0   NM_079668.2  CG7467-RB, transcript variant B (osa), mRNA 
0   NM_175954.1  CG33123-RA (CG33123), mRNA 
0   NM_141046.3  CG7605-RA (Rab26), mRNA 
0   NM_133165.2  CG1079-RA (CG1079), mRNA 
0   NM_137854.2  CG4373-RA (Cyp6d2), mRNA 
0   NM_058135.2  CG10917-RA (fj), mRNA 
0   NM_136657.2  CG1818-RA (Updo), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.