National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 7480R-3 
 Symbol Pgant35A  Full Name Polypeptide N-acetylgalactosaminyltransferase 35A 
 CG No CG7480  Old CG No CG7480 
 Synonyms pgant35, CG7480, l(2)35Aa, dGalNAc-T1, pgant35A, BG:DS01068.8, GalNAc-T, l(2)br12, l35Aa, br12, A3, Pgant35A 
 Accession No (Link to NCBI)  
 Inserted Chr.
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
Yamamoto-Hino M, Yoshida H, Ichimiya T, Sakamura S, Maeda M, Kimura Y, Sasaki N, Aoki-Kinoshita KF, Kinoshita-Toyoda A, Toyoda H, Ueda R, Nishihara S, Goto S.
Phenotype-based clustering of glycosylation-related genes by RNAi-mediated gene silencing.
Genes Cells (2015) 20(6) 521-42 [ PubMed ID = 25940448 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgATGATGCAAATCAAGCGCCTC   
 Primer Seq. 3'
aatctagaggtaccGAGCGCATCAGCGTCATCTTG   
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 ATGATGCAAA TCAAGCGCCT CCTGTGCAAA TCCTGCGGCC TGGGCACCCT TCTGGTGGCG 
0061 GTCGTCTGGC TGCTGGCGCT GCTTTTCTAC TCGCACAGCC TGCGCAGCTC CATCCGCTCG 
0121 GCAGGATGGA GGATCGACGA AGGGAACGCA ACGCCACGGG CCGAGCTGAG CTACCAGGCC 
0181 AGGGTCACCG TCGGATGCAC TCCAAATGCC AGCATTACCA CTGGCGAATC GCCGGCGGCA 
0241 CCCAAGCCGC CCAGTGATCC GGAGCAATTG GAACTGTTGG GTGTGGTGCG CAACAAGCAG 
0301 GACAAGTACA TACGCGACAT TGGCTACAAG CATCACGCCT TCAACGCGCT GGTGTCCAAT 
0361 AACATAGGAC TCTTCCGGGC GATCCCAGAC ACTCGGCACA AGGTGTGCGA TCGCCAGGAG 
0421 ACCACGGAAG CGGAAAATCT CGCCCAGGCC TCCATAGTCA TGTGCTTCTA CAACGAGCAC 
0481 AAGATGACGC TGATGCGCTC  
 in silico PCR Fragment
0001 atgatgcaaa tcaagcgcct cctgtgcaaa tcctgcggcc tgggcaccct tctggtggcg 
0061 gtcgtctggc tgctggcgct gcttttctac tcgcacagcc tgcgcagctc catccgctcg 
0121 gcaggatgga ggatcgacga agggaacgca acgccacggg ccgagctgag ctaccaggcc 
0181 agggtcaccg tcggatgcac tccaaatgcc agcattacca ctggcgaatc gccggcggca 
0241 cccaagccgc ccagtgatcc ggagcaattg gaactgttgg gtgtggtgcg caacaagcag 
0301 gacaagtaca tacgcgacat tggctacaag catcacgcct tcaacgcgct ggtgtccaat 
0361 aacataggac tcttccgggc gatcccagac actcggcaca aggtgtgcga tcgccaggag 
0421 accacggaag cggaaaatct gccccaggcc tccatagtca tgtgcttcta caacgagcac 
0481 aagatgacgc tgatgcgctc  
 Assemble Data

7480R-3.IR full       1   ATGATGCAAATCAAGCGCCTCCTGTGCAAATCCTGCGGCCTGGGCACCCTTCTGGTGGCG 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7480R-3.in silico     1   ATGATGCAAATCAAGCGCCTCCTGTGCAAATCCTGCGGCCTGGGCACCCTTCTGGTGGCG 60


7480R-3.IR full       61  GTCGTCTGGCTGCTGGCGCTGCTTTTCTACTCGCACAGCCTGCGCAGCTCCATCCGCTCG 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7480R-3.in silico     61  GTCGTCTGGCTGCTGGCGCTGCTTTTCTACTCGCACAGCCTGCGCAGCTCCATCCGCTCG 120


7480R-3.IR full       121 GCAGGATGGAGGATCGACGAAGGGAACGCAACGCCACGGGCCGAGCTGAGCTACCAGGCC 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7480R-3.in silico     121 GCAGGATGGAGGATCGACGAAGGGAACGCAACGCCACGGGCCGAGCTGAGCTACCAGGCC 180


7480R-3.IR full       181 AGGGTCACCGTCGGATGCACTCCAAATGCCAGCATTACCACTGGCGAATCGCCGGCGGCA 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7480R-3.in silico     181 AGGGTCACCGTCGGATGCACTCCAAATGCCAGCATTACCACTGGCGAATCGCCGGCGGCA 240


7480R-3.IR full       241 CCCAAGCCGCCCAGTGATCCGGAGCAATTGGAACTGTTGGGTGTGGTGCGCAACAAGCAG 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7480R-3.in silico     241 CCCAAGCCGCCCAGTGATCCGGAGCAATTGGAACTGTTGGGTGTGGTGCGCAACAAGCAG 300


7480R-3.IR full       301 GACAAGTACATACGCGACATTGGCTACAAGCATCACGCCTTCAACGCGCTGGTGTCCAAT 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7480R-3.in silico     301 GACAAGTACATACGCGACATTGGCTACAAGCATCACGCCTTCAACGCGCTGGTGTCCAAT 360


7480R-3.IR full       361 AACATAGGACTCTTCCGGGCGATCCCAGACACTCGGCACAAGGTGTGCGATCGCCAGGAG 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7480R-3.in silico     361 AACATAGGACTCTTCCGGGCGATCCCAGACACTCGGCACAAGGTGTGCGATCGCCAGGAG 420


7480R-3.IR full       421 ACCACGGAAGCGGAAAATCTCGCCCAGGCCTCCATAGTCATGTGCTTCTACAACGAGCAC 480
                          ||||||||||||||||||||  ||||||||||||||||||||||||||||||||||||||
7480R-3.in silico     421 ACCACGGAAGCGGAAAATCTGCCCCAGGCCTCCATAGTCATGTGCTTCTACAACGAGCAC 480


7480R-3.IR full       481 AAGATGACGCTGATGCGCTC 500
                          ||||||||||||||||||||
7480R-3.in silico     481 AAGATGACGCTGATGCGCTC 500

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100  485  NM_143812.2  Polypeptide N-acetylgalactosaminyltransferase 35A CG7480-RA (Pgant35A), mRNA 
NM_078929.2  photorepair CG11205-RA, transcript variant A (phr), mRNA 
NM_165564.1  photorepair CG11205-RB, transcript variant B (phr), mRNA 
NM_165566.1  CG18853-RA (CG18853), mRNA 
NM_141381.2  Osiris 17 CG15598-RA (Osi17), mRNA 
NM_167752.1  sluggish A CG1417-RD, transcript variant D (slgA), mRNA 
NM_167753.1  sluggish A CG1417-RB, transcript variant B (slgA), mRNA 
NM_164375.1  split ends CG18497-RC, transcript variant C (spen), mRNA 
NM_164374.1  split ends CG18497-RA, transcript variant A (spen), mRNA 
NM_079979.2  split ends CG18497-RB, transcript variant B (spen), mRNA 
NM_143574.1  CG15546-RA (CG15546), mRNA 
NM_001043112.1  zormin CG33484-RB, transcript variant B (zormin), mRNA 
NM_001043114.1  zormin CG33484-RD, transcript variant D (zormin), mRNA 
NM_206240.1  zormin CG33484-RA, transcript variant A (zormin), mRNA 
NM_001043113.1  zormin CG33484-RC, transcript variant C (zormin), mRNA 
NM_138988.2  A3-3 CG11405-RA (A3-3), mRNA 
NM_140971.1  CG5195-RA (CG5195), mRNA 
NM_132225.1  CG18262-RA (CG18262), mRNA 
NM_137736.1  CG15666-RA (CG15666), mRNA 
NM_140714.3  Myoinhibiting peptide precursor CG6456-RA (Mip), mRNA 
NM_079939.2  scribbler CG5580-RA, transcript variant A (sbb), mRNA 
NM_137319.2  CG6426-RA (CG6426), mRNA 
NM_176497.1  CG9297-RB, transcript variant B (CG9297), mRNA 
NM_176498.1  CG9297-RA, transcript variant A (CG9297), mRNA 
NM_079204.1  Tie-like receptor tyrosine kinase CG7525-RA (Tie), mRNA 
NM_139692.1  CG4611-RA (CG4611), mRNA 
NM_166630.1  CG5594-RD, transcript variant D (CG5594), mRNA 
NM_166631.1  CG5594-RA, transcript variant A (CG5594), mRNA 
NM_131901.2  CG5594-RC, transcript variant C (CG5594), mRNA 
NM_142218.1  CG18522-RA (CG18522), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.