National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 7479R-1 
 Symbol Aats-leu  Full Name Leucyl-tRNA synthetase 
 CG No CG7479  Old CG No CG7479 
 Synonyms LeuRS, LRS, CG7479, Aats-leu 
 Accession No (Link to NCBI) NM_139675.2 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Arsham AM, Neufeld TP.
A genetic screen in Drosophila reveals novel cytoprotective functions of the autophagy-lysosome pathway.
PLoS ONE (2009) 4(6) e6068 [ PubMed ID = 19562034 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgTTGGGGAGCTGTCTACTGGAA 
 Primer Seq. 3'
aatctagaggtaccCATGGCGATGGAGCATTAGGA 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 TTGGGGAGCT GTCTACTGGA ATAGCTGGCG GCGCCTGCTA ACCCAAAGCT GCACGGGGAA 
0061 TGATAATCCA GAGCTAACCA GTGATGTCAA GCACCGGATT GAGGCTCATT GGCGGGAACA 
0121 GCTCAGTGGA GGACAGTTCA ATCCCAAGGA CTCGCAGGAC AAGTACTACG TGCTCTCCAT 
0181 GTTCCCGTAT CCCTCCGGCA ATCTTCACAT GGGCCATGTG CGCCGTCTAT ACCATAGCCG 
0241 ATTCGGTGGC TCGTTTCCAG CGAATGTGCG GCAAGAATGT GTTTCAGCCA ATGGGCTGGG 
0301 ATTCCTTTGG GCTGCCCGCC GAGAACGCCG CCAATCAGCG TGGGGTGGAG CCCGCGTCCT 
0361 GGACGGAGCA GAACATTGCC CAGATGAAGG AACAACTCAA GCGACTTGGT TGCTCCTTTG 
0421 ACTGGAACCA TGAATTGTCC ACCTGCAGTC CAAAATACTA CAAGTGGACG CAGCATCTGT 
0481 TCCTAATGCT CCATCGCCAT G 
 in silico PCR Fragment
0001 TTGGGGAGCT GTCTACTGGA ATAGCTGGCG GCGCCTGCTA ACCCAAAGCT GCACCCGGAA 
0061 TGATAATCCA GAGCTAACCA GTGATGTCAA GCACCGGATT GAGGCTCATT GGCGGGAGCA 
0121 GCTCAGTGGA GGACAGTTCA ATCCCAAGGA CTCGCAGGAC AAGTACTACG TGCTCTCCAT 
0181 GTTCCCGTAT CCCTCCGGCA ATCTTCACAT GGGCCATGTG CG-CGTCTAT ACCATAGCCG 
0241 ATTCGGTGGC TCGTTTCCAG CGAATGTGCG GCAAGAATGT GTTTCAGCCA ATGGGTTGGG 
0301 ATTCCTTTGG GCTGCCCGCC GAGAACGCCG CCAATCAGCG TGGGGTGGAG CCCGCGTCCT 
0361 GGACGGAGCA GAACATTGCC CAGATGAAGG AACAACTCAA GCGACTTGGT TGCTCCTTTG 
0421 ACTGGAACCA TGAATTGTCC ACCTGCAGTC CAAAATACTA CAAGTGGACG CAGCATCTGT 
0481 TCCTAATGCT CCATCGCCAT G 
 Assemble Data

7479R-1.IR_full       1   TTGGGGAGCTGTCTACTGGAATAGCTGGCGGCGCCTGCTAACCCAAAGCTGCACGGGGAA 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||  ||||
7479R-1.in silico     1   TTGGGGAGCTGTCTACTGGAATAGCTGGCGGCGCCTGCTAACCCAAAGCTGCACCCGGAA 60


7479R-1.IR_full       61  TGATAATCCAGAGCTAACCAGTGATGTCAAGCACCGGATTGAGGCTCATTGGCGGGAACA 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||
7479R-1.in silico     61  TGATAATCCAGAGCTAACCAGTGATGTCAAGCACCGGATTGAGGCTCATTGGCGGGAGCA 120


7479R-1.IR_full       121 GCTCAGTGGAGGACAGTTCAATCCCAAGGACTCGCAGGACAAGTACTACGTGCTCTCCAT 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7479R-1.in silico     121 GCTCAGTGGAGGACAGTTCAATCCCAAGGACTCGCAGGACAAGTACTACGTGCTCTCCAT 180


7479R-1.IR_full       181 GTTCCCGTATCCCTCCGGCAATCTTCACATGGGCCATGTGCGCCGTCTATACCATAGCCG 240
                          |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||
7479R-1.in silico     181 GTTCCCGTATCCCTCCGGCAATCTTCACATGGGCCATGTGCG-CGTCTATACCATAGCCG 240


7479R-1.IR_full       241 ATTCGGTGGCTCGTTTCCAGCGAATGTGCGGCAAGAATGTGTTTCAGCCAATGGGCTGGG 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||
7479R-1.in silico     241 ATTCGGTGGCTCGTTTCCAGCGAATGTGCGGCAAGAATGTGTTTCAGCCAATGGGTTGGG 300


7479R-1.IR_full       301 ATTCCTTTGGGCTGCCCGCCGAGAACGCCGCCAATCAGCGTGGGGTGGAGCCCGCGTCCT 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7479R-1.in silico     301 ATTCCTTTGGGCTGCCCGCCGAGAACGCCGCCAATCAGCGTGGGGTGGAGCCCGCGTCCT 360


7479R-1.IR_full       361 GGACGGAGCAGAACATTGCCCAGATGAAGGAACAACTCAAGCGACTTGGTTGCTCCTTTG 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7479R-1.in silico     361 GGACGGAGCAGAACATTGCCCAGATGAAGGAACAACTCAAGCGACTTGGTTGCTCCTTTG 420


7479R-1.IR_full       421 ACTGGAACCATGAATTGTCCACCTGCAGTCCAAAATACTACAAGTGGACGCAGCATCTGT 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7479R-1.in silico     421 ACTGGAACCATGAATTGTCCACCTGCAGTCCAAAATACTACAAGTGGACGCAGCATCTGT 480


7479R-1.IR_full       481 TCCTAATGCTCCATCGCCATG 501
                          |||||||||||||||||||||
7479R-1.in silico     481 TCCTAATGCTCCATCGCCATG 501

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_139675.2  CG7479-RA (Aats-leu), mRNA 
0   11  NM_134516.2  CG32529-RA, transcript variant A (CG32529), mRNA 
0   NM_167688.1  CG32529-RC, transcript variant C (CG32529), mRNA 
0   NM_001038766.1  CG32529-RD, transcript variant D (CG32529), mRNA 
0   NM_080095.2  CG9124-RA, transcript variant A (eIF-3p40), mRNA 
0   NM_205909.1  CG9124-RB, transcript variant B (eIF-3p40), mRNA 
0   NM_001043006.1  CG33554-RB, transcript variant B (Nipped-A), mRNA 
0   NM_001043007.1  CG33554-RC, transcript variant C (Nipped-A), mRNA 
0   NM_001014499.2  CG33554-RA, transcript variant A (Nipped-A), mRNA 
0   NM_135581.1  CG7329-RA (CG7329), mRNA 
0   NM_142142.1  CG7292-RA (Rrp6), mRNA 
0   NM_135080.1  CG12512-RA (CG12512), mRNA 
0   NM_132515.2  CG1841-RA, transcript variant A (Tango10), mRNA 
0   NM_167302.1  CG1841-RB, transcript variant B (Tango10), mRNA 
0   NM_169828.1  CG31229-RA (CG31229), mRNA 
0   NM_132212.2  CG1575-RA (CG1575), mRNA 
0   NM_164603.1  CG12787-RB, transcript variant B (hoe1), mRNA 
0   NM_175968.1  CG12787-RF, transcript variant F (hoe1), mRNA 
0   NM_135032.1  CG12787-RC, transcript variant C (hoe1), mRNA 
0   NM_175967.1  CG12787-RE, transcript variant E (hoe1), mRNA 
0   NM_175966.1  CG12787-RD, transcript variant D (hoe1), mRNA 
0   NM_057657.4  CG17158-RA (cpb), mRNA 
0   NM_135031.3  CG12787-RA, transcript variant A (hoe1), mRNA 
0   NM_167311.1  CG1847-RB, transcript variant B (CG1847), mRNA 
0   NM_132530.2  CG1847-RA, transcript variant A (CG1847), mRNA 
0   NM_140080.1  CG3335-RA (CG3335), mRNA 
0   NM_142942.3  CG31140-RA, transcript variant A (CG31140), mRNA 
0   NM_206552.1  CG31140-RC, transcript variant C (CG31140), mRNA 
0   NM_206553.1  CG31140-RB, transcript variant B (CG31140), mRNA 
0   NM_134670.2  CG3625-RB, transcript variant B (CG3625), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.