National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 7440R-2 
 Symbol tgy  Full Name twiggy 
 CG No CG7440  Old CG No CG7440 
 Synonyms CG7440, tgy 
 Accession No (Link to NCBI)  
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
Yamamoto-Hino M, Yoshida H, Ichimiya T, Sakamura S, Maeda M, Kimura Y, Sasaki N, Aoki-Kinoshita KF, Kinoshita-Toyoda A, Toyoda H, Ueda R, Nishihara S, Goto S.
Phenotype-based clustering of glycosylation-related genes by RNAi-mediated gene silencing.
Genes Cells (2015) 20(6) 521-42 [ PubMed ID = 25940448 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgCTGTGGGGCAAGACCAAAGAG 
 Primer Seq. 3'
aatctagaggtaccACATAGTGAAAGGCCACCGGG 
 Predicted Fragment Size
524 
 IR fragment full Seq
 
 in silico PCR Fragment
 
 Assemble Data

7440R-2.IR full       1   CTGTGGGGCAAGACCAAAGAGGCCTTTGTCCACATCCACGAGCAGATGCGCCACGAGGCG 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7440R-2.in silico     1   CTGTGGGGCAAGACCAAAGAGGCCTTTGTCCACATCCACGAGCAGATGCGCCACGAGGCG 60


7440R-2.IR full       61  GATTGGTTCATAAAGGCGGACGACGACACCTACCTCTTTTTGGAAAATCTGCGCTACATG 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7440R-2.in silico     61  GATTGGTTCATAAAGGCGGACGACGACACCTACCTCTTTTTGGAAAATCTGCGCTACATG 120


7440R-2.IR full       121 CTCTACCCGTATTCACCGGAGACACCTATTTATTTTGGATTTAATTACAAGATGGTCGGC 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7440R-2.in silico     121 CTCTACCCGTATTCACCGGAGACACCTATTTATTTTGGATTTAATTACAAGATGGTCGGC 180


7440R-2.IR full       181 ACTCACCAGAAGAACGAGTCATACATGTCCGGCGGCAGTGGCTACGTACTGAGCCGCGAG 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7440R-2.in silico     181 ACTCACCAGAAGAACGAGTCATACATGTCCGGCGGCAGTGGCTACGTACTGAGCCGCGAG 240


7440R-2.IR full       241 GCTCTTAGGATNTTNTCCGAGGGCGTCAACGACACCACCAAGTGTCGCCAGGAGGACGAT 300
                          ||||||||||| ||  ||||||||||||||||||||||||||||||||||||||||||||
7440R-2.in silico     241 GCTCTTAGGATCTTCGCCGAGGGCGTCAACGACACCACCAAGTGTCGCCAGGAGGACGAT 300


7440R-2.IR full       301 CACGCCGAGGACGTCGAGATGGGCAAGTGCCTGTTCAACCTGGGCGTGAAGGCGGGTGAT 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7440R-2.in silico     301 CACGCCGAGGACGTCGAGATGGGCAAGTGCCTGTTCAACCTGGGCGTGAAGGCGGGTGAT 360


7440R-2.IR full       361 TCCAGGGACGAGCAGCTGCGCAATCGCTTCTATCCCATAGCTCCTTATGGAGCCCTTCTC 420
                          ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||
7440R-2.in silico     361 TCCAGGGACGAGCAGCTGCGCAACCGCTTCTATCCCATAGCTCCTTATGGAGCCCTTCTC 420


7440R-2.IR full       421 TCGGGTAACGTCGGCATGGACTTTTGGTTGTACAAGTACGCCTACTACAATCCGAGATCG 480
                          ||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||
7440R-2.in silico     421 TCGGGCAACGTTGGCATGGACTTTTGGTTGTACAAGTACGCCTACTACAATCCGAGATCG 480


7440R-2.IR full       481 TGCATGGACTGCNTGTCGGAGTACCCGGTGGCCTTTCACTATGT 524
                          |||||||||||| |||||||||||||||||||||||||||||||
7440R-2.in silico     481 TGCATGGACTGCCTGTCGGAGTACCCGGTGGCCTTTCACTATGT 524

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100  506  NM_133121.3  twiggy CG7440-RA, transcript variant A (tgy), mRNA 
96.44  488  NM_001038765.1  twiggy CG7440-RB, transcript variant B (tgy), mRNA 
NM_141797.2  CG17726-RA (CG17726), mRNA 
NM_168366.2  CG32046-RB, transcript variant B (CG32046), mRNA 
NM_168367.1  CG32046-RA, transcript variant A (CG32046), mRNA 
NM_167193.1  CG32702-RA (CG32702), mRNA 
NM_079935.2  Hexokinase C CG8094-RA (Hex-C), mRNA 
NM_139603.2  Chd64 CG14996-RB (Chd64), mRNA 
NM_135674.2  CG14937-RA (CG14937), mRNA 
NM_001042897.1  moladietz CG4482-RD, transcript variant D (mol), mRNA 
NM_135889.3  moladietz CG4482-RA, transcript variant A (mol), mRNA 
NM_165094.2  moladietz CG4482-RB, transcript variant B (mol), mRNA 
NM_001042898.1  moladietz CG4482-RC, transcript variant C (mol), mRNA 
NM_001042899.1  moladietz CG4482-RE, transcript variant E (mol), mRNA 
NM_001038771.2  folded gastrulation CG9559-RB, transcript variant B (fog), mRNA 
NM_078714.5  folded gastrulation CG9559-RA, transcript variant A (fog), mRNA 
15  NM_134876.1  CG18558-RA (CG18558), mRNA 
NM_001038891.1  CG34057-RA, transcript variant A (CG34057), mRNA 
NM_001038892.1  CG34057-RB, transcript variant B (CG34057), mRNA 
NM_079729.2  Dicer-1 CG4792-RA (Dcr-1), mRNA 
28  NM_164839.1  CG9520-RA, transcript variant A (CG9520), mRNA 
28  NM_164840.1  CG9520-RC, transcript variant C (CG9520), mRNA 
28  NM_135414.2  CG9520-RB, transcript variant B (CG9520), mRNA 
NM_141979.1  CG10909-RA (CG10909), mRNA 
NM_134875.1  CG2975-RA (CG2975), mRNA 
NM_141072.2  CG7177-RA (CG7177), mRNA 
NM_001015222.1  CG40351-PB.3 (CG40351), mRNA 
NM_165689.1  CG1902-RC, transcript variant C (CG1902), mRNA 
NM_136663.2  CG1902-RA, transcript variant A (CG1902), mRNA 
NM_001015221.1  CG40351-PA.3 (CG40351), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.