National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 7429R-6 
 Symbol CG7429  Full Name CG7429 
 CG No CG7429  Old CG No CG7429 
 Synonyms CG7429 
 Accession No (Link to NCBI) NM_135334.3 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
Verboon JM, Nakamura M, Davidson KA, Decker JR, Nandakumar V, Parkhurst SM.
Wash and the wash regulatory complex function in nuclear envelope budding.
J. Cell. Sci. (2020) [ PubMed ID = 32503943 ] [ RRC reference ]

Tiwari P, Kumar A, Das RN, Malhotra V, VijayRaghavan K.
A Tendon Cell Specific RNAi Screen Reveals Novel Candidates Essential for Muscle Tendon Interaction.
PLoS ONE (2015) 10(10) e0140976 [ PubMed ID = 26488612 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgTGGATGCAACTGCAGCAATCA 
 Primer Seq. 3'
aatctagaggtaccTCGGGTGTGTCTAAAATACGC 
 Predicted Fragment Size
499 
 IR fragment full Seq
0001 TGGATGCAAC TGCAGCAATC ACCGGCAATG TGGACAAGAC CCAGATACCG CCGCTGAACC 
0061 AGAAACGCAT CCTGGCCTTC GTTAACCATT TCNCTCGTCA GCACCTGCAC CTTTCTAAAT 
0121 GAATTTGCCC TGGGCTGNTG AGACGAAGTT CGTGGAGATG GAACGGCAGC TGCAGAAAGA 
0181 CGGAGGCCGC CCTCATCATC CTGGAGGCCA AGCTGGCGTC CATACCCACT GAGCACCATG 
0241 TAGCGACTGA GGCTACCGAA GCGCCAGCGA TATCAAATCA GCAACAACAC GAAGAAGCAT 
0301 CCATGGTGGA CACCACGGAA CCACCGACCA CCGAGAATCC TACGGAGCCG GAACTCCCGC 
0361 CTGAATCGGT TGGTGTGCGC GCCTGTGAAG ATCTACGTTA CAGAAAGTTC TTCAAAATGG 
0421 TGCAAGTGGG TGTGcCCGCA CCGGCGGTCA AGCAGAAAAT GCAATCCGAA GGTCTGGAGC 
0481 CGCGTATTTT AGACACACCC GA 
 in silico PCR Fragment
0001 TGGATGCAAC TGCAGCAATC ACCGGCAATG TGGACAAGAC CCAGATACCG CCGCTGAACC 
0061 AGAAACGCAT CCTGGCCTTC GTTAACCATT TC-CTCGTCA GCACCTGCAC CTTTCTAAAT 
0121 GAATTTGCCC TGGGCTG-TG AGACGAAGTT CGTGGAGATG GAACGGCAGC TGCAG-AAGA 
0181 CGGAGGCCGC CCTCATCATC CTGGAGGCCA AGCTGGCGTC TATACCCACC GAGCACCATG 
0241 TAGCGACTGA GGCTACCGAA GCGCCAGCGA TATCAAACCA GCAACGCAAC GAAGAAGCAT 
0301 CCATGGTGGA CACCACGGAA CCACCGACCA CCGAGAATCC TACGGAGCCG GAACTCCCGC 
0361 CTGAATCGGT TGGTGTGCGC GCCTGTGAAG ATCAACGTTA CAGAAAGTTC TTCAAAATGG 
0421 TGCAAGTGGG TGTGCCCGCA CCGGCGGTTA AGCAGAAAAT GCAATCCGAA GGTCTGGAGC 
0481 CGCGTATTTT AGACACACCC GA 
 Assemble Data

7429R-6.IR_full       1   TGGATGCAACTGCAGCAATCACCGGCAATGTGGACAAGACCCAGATACCGCCGCTGAACC 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7429R-6.in silico     1   TGGATGCAACTGCAGCAATCACCGGCAATGTGGACAAGACCCAGATACCGCCGCTGAACC 60


7429R-6.IR_full       61  AGAAACGCATCCTGGCCTTCGTTAACCATTTCNCTCGTCAGCACCTGCACCTTTCTAAAT 120
                          |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||
7429R-6.in silico     61  AGAAACGCATCCTGGCCTTCGTTAACCATTTC-CTCGTCAGCACCTGCACCTTTCTAAAT 120


7429R-6.IR_full       121 GAATTTGCCCTGGGCTGNTGAGACGAAGTTCGTGGAGATGGAACGGCAGCTGCAGAAAGA 180
                          ||||||||||||||||| ||||||||||||||||||||||||||||||||||||| ||||
7429R-6.in silico     121 GAATTTGCCCTGGGCTG-TGAGACGAAGTTCGTGGAGATGGAACGGCAGCTGCAG-AAGA 180


7429R-6.IR_full       181 CGGAGGCCGCCCTCATCATCCTGGAGGCCAAGCTGGCGTCCATACCCACTGAGCACCATG 240
                          |||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||||
7429R-6.in silico     181 CGGAGGCCGCCCTCATCATCCTGGAGGCCAAGCTGGCGTCTATACCCACCGAGCACCATG 240


7429R-6.IR_full       241 TAGCGACTGAGGCTACCGAAGCGCCAGCGATATCAAATCAGCAACAACACGAAGAAGCAT 300
                          ||||||||||||||||||||||||||||||||||||| |||||||   ||||||||||||
7429R-6.in silico     241 TAGCGACTGAGGCTACCGAAGCGCCAGCGATATCAAACCAGCAACGCAACGAAGAAGCAT 300


7429R-6.IR_full       301 CCATGGTGGACACCACGGAACCACCGACCACCGAGAATCCTACGGAGCCGGAACTCCCGC 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7429R-6.in silico     301 CCATGGTGGACACCACGGAACCACCGACCACCGAGAATCCTACGGAGCCGGAACTCCCGC 360


7429R-6.IR_full       361 CTGAATCGGTTGGTGTGCGCGCCTGTGAAGATCTACGTTACAGAAAGTTCTTCAAAATGG 420
                          ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||
7429R-6.in silico     361 CTGAATCGGTTGGTGTGCGCGCCTGTGAAGATCAACGTTACAGAAAGTTCTTCAAAATGG 420


7429R-6.IR_full       421 TGCAAGTGGGTGTGCCCGCACCGGCGGTCAAGCAGAAAATGCAATCCGAAGGTCTGGAGC 480
                          |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||
7429R-6.in silico     421 TGCAAGTGGGTGTGCCCGCACCGGCGGTTAAGCAGAAAATGCAATCCGAAGGTCTGGAGC 480


7429R-6.IR_full       481 CGCGTATTTTAGACACACCCGA 502
                          ||||||||||||||||||||||
7429R-6.in silico     481 CGCGTATTTTAGACACACCCGA 502

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   481  NM_135334.3  CG7429-RA (CG7429), mRNA 
0   NM_137582.2  CG11237-RA (Oseg6), mRNA 
0   NM_079901.2  CG10811-RA (eIF-4G), mRNA 
0   NM_134764.2  CG31935-RA (CG31935), mRNA 
0   NM_141884.3  CG14734-RA (Tk), mRNA 
0   NM_136127.1  CG13084-RA (CG13084), mRNA 
0   NM_139371.1  CG13917-RA (CG13917), mRNA 
0   NM_132187.2  CG17256-RA (Nek2), mRNA 
0   NM_143464.2  CG1972-RA (CG1972), mRNA 
0   NM_001043162.1  CG40300-RC, transcript variant C (CG40300), mRNA 
0   NM_001043164.1  CG40300-RB, transcript variant B (CG40300), mRNA 
0   NM_001043163.1  CG40300-RA, transcript variant A (CG40300), mRNA 
0   11  NM_132932.2  CG9634-RA (CG9634), mRNA 
0   NM_080055.2  CG3895-RA (ph-d), mRNA 
0   NM_057523.3  CG18412-RA (ph-p), mRNA 
0   NM_134997.2  CG17840-RA (CG17840), mRNA 
0   NM_138220.1  CG13889-RA (CG13889), mRNA 
0   NM_133139.1  CG14196-RA (CG14196), mRNA 
0   NM_001015104.1  CG41048-PA.3 (CG41048), mRNA 
0   NM_139493.2  CG2083-RA (CG2083), mRNA 
0   NM_168171.1  CG32397-RA (CG32397), mRNA 
0   NM_057853.2  CG2189-RA (Dfd), mRNA 
0   13  NM_001014630.1  CG33547-RA (Rim), mRNA 
0   NM_166057.1  CG8787-RA, transcript variant A (Asx), mRNA 
0   NM_078946.3  CG2328-RA (eve), mRNA 
0   NM_142073.3  CG2328-RA (eve), mRNA, sub-group O CG3143-RA, transcript variant A (foxo), mRNA 
0   NM_132086.1  CG15894-RA (CG15894), mRNA 
0   NM_136593.1  CG8181-RA (CG8181), mRNA 
0   NM_132800.1  CG15642-RA (CG15642), mRNA 
0   NM_135386.3  CG13401-RA, transcript variant A (U26), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.