National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 7429R-1 
 Symbol CG7429  Full Name CG7429 
 CG No CG7429  Old CG No CG7429 
 Synonyms CG7429 
 Accession No (Link to NCBI) NM_135334.3 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
[Please submit your publication]
Verboon JM, Nakamura M, Davidson KA, Decker JR, Nandakumar V, Parkhurst SM.
Wash and the wash regulatory complex function in nuclear envelope budding.
J. Cell. Sci. (2020) [ PubMed ID = 32503943 ] [ RRC reference ]

Tiwari P, Kumar A, Das RN, Malhotra V, VijayRaghavan K.
A Tendon Cell Specific RNAi Screen Reveals Novel Candidates Essential for Muscle Tendon Interaction.
PLoS ONE (2015) 10(10) e0140976 [ PubMed ID = 26488612 ] [ RRC reference ]

Umemori M, Habara O, Iwata T, Maeda K, Nishinoue K, Okabe A, Takemura M, Takahashi K, Saigo K, Ueda R, Adachi-Yamada T.
RNAi-mediated knockdown showing impaired cell survival in Drosophila wing imaginal disc.
Gene Regul Syst Bio (2009) 3 11-20 [ PubMed ID = 19838331 ] [ RRC reference ]  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     1   TGGATGCAACTGCAGCAATCACCGGCAATGTGGACAAGACCCAGATACCGCCGCTGAACC 60

                          |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| silico     61  AGAAACGCATCCTGGCCTTCGTTAACCATTTC-CTCGTCAGCACCTGCACCTTTCTAAAT 120

                          ||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |||| silico     121 GAATTTGCCCTGGGCTG-TGAGACGAAGTTCGTGGAGATGGAACGGCAGCTGCAG-AAGA 180

                          |||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||| silico     181 CGGAGGCCGCCCTCATCATCCTGGAGGCCAAGCTGGCGTCTATACCCACCGAGCACCATG 240

                          ||||||||||||||||||||||||||||||||||||| |||||||   |||||||||||| silico     241 TAGCGACTGAGGCTACCGAAGCGCCAGCGATATCAAACCAGCAACGCAACGAAGAAGCAT 300

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     301 CCATGGTGGACACCACGGAACCACCGACCACCGAGAATCCTACGGAGCCGGAACTCCCGC 360

                          ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| silico     361 CTGAATCGGTTGGTGTGCGCGCCTGTGAAGATCAACGTTACAGAAAGTTCTTCAAAATGG 420

                          |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| silico     421 TGCAAGTGGGTGTGCCCGCACCGGCGGTTAAGCAGAAAATGCAATCCGAAGGTCTGGAGC 480

7429R-1.IR_full       481 CGCGTATTTTAGACACACCCGA 502
                          |||||||||||||||||||||| silico     481 CGCGTATTTTAGACACACCCGA 502

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   481  NM_135334.3  CG7429-RA (CG7429), mRNA 
0   NM_137582.2  CG11237-RA (Oseg6), mRNA 
0   NM_079901.2  CG10811-RA (eIF-4G), mRNA 
0   NM_134764.2  CG31935-RA (CG31935), mRNA 
0   NM_141884.3  CG14734-RA (Tk), mRNA 
0   NM_136127.1  CG13084-RA (CG13084), mRNA 
0   NM_139371.1  CG13917-RA (CG13917), mRNA 
0   NM_132187.2  CG17256-RA (Nek2), mRNA 
0   NM_143464.2  CG1972-RA (CG1972), mRNA 
0   NM_001043162.1  CG40300-RC, transcript variant C (CG40300), mRNA 
0   NM_001043164.1  CG40300-RB, transcript variant B (CG40300), mRNA 
0   NM_001043163.1  CG40300-RA, transcript variant A (CG40300), mRNA 
0   11  NM_132932.2  CG9634-RA (CG9634), mRNA 
0   NM_080055.2  CG3895-RA (ph-d), mRNA 
0   NM_057523.3  CG18412-RA (ph-p), mRNA 
0   NM_134997.2  CG17840-RA (CG17840), mRNA 
0   NM_138220.1  CG13889-RA (CG13889), mRNA 
0   NM_133139.1  CG14196-RA (CG14196), mRNA 
0   NM_001015104.1  CG41048-PA.3 (CG41048), mRNA 
0   NM_139493.2  CG2083-RA (CG2083), mRNA 
0   NM_168171.1  CG32397-RA (CG32397), mRNA 
0   NM_057853.2  CG2189-RA (Dfd), mRNA 
0   13  NM_001014630.1  CG33547-RA (Rim), mRNA 
0   NM_166057.1  CG8787-RA, transcript variant A (Asx), mRNA 
0   NM_078946.3  CG2328-RA (eve), mRNA 
0   NM_142073.3  CG2328-RA (eve), mRNA, sub-group O CG3143-RA, transcript variant A (foxo), mRNA 
0   NM_132086.1  CG15894-RA (CG15894), mRNA 
0   NM_136593.1  CG8181-RA (CG8181), mRNA 
0   NM_132800.1  CG15642-RA (CG15642), mRNA 
0   NM_135386.3  CG13401-RA, transcript variant A (U26), mRNA 
 Wing Disc
JNK signal
Caspase-3 signal
Dcompartment   Penetrance

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.