National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 7405R-1 
 Symbol CycH  Full Name Cyclin H 
 CG No CG7405  Old CG No CG7405 
 Synonyms 142767_at, CG7405, CycH 
 Accession No (Link to NCBI) NM_079483.2 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Shih HT, Chen WY, Liu KY, Shih ZS, Chen YJ, Hsieh PC, Kuo KL, Huang KH, Hsu PH, Liu YW, Chan SP, Lee HH, Tsai YC, Wu JT.
dBRWD3 Regulates Tissue Overgrowth and Ectopic Gene Expression Caused by Polycomb Group Mutations.
PLoS Genet. (2016) 12(9) e1006262 [ PubMed ID = 27588417 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgATGTATCCTGTGAGCTCGCAA 
 Primer Seq. 3'
aatctagaggtaccAAACCCTCGATGGGTCTGAAC 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 ATGTATCCTG TGAGCTCGCA AAAGAGGTCC TGGACATTCG CCAATGAGGG CCAGCTCATG 
0061 GAGTTCCGCG TGGAGcAGAA CAGCAAGTAC ATCGAGTCGC ACGAGGAGGA GGCGCAGGGT 
0121 CgNGACCTCA ATGAGCACTT TCTCACGTCG GCGGAGGAGC GcCTGTNTGC TGAAGCAGTA 
0181 CGAGATCTAC CTGTTCGATT TCTGCCGCCG CTTCGAACCG ACGATGCCCA AGTGCGTTGT 
0241 GGGCACGGCC TNTCCACTAC TTCAAGCGGT TCTATCTGAA CAACTCCCCC ATGGACTATC 
0301 ACCCCAAGGA GATTCTAAGC CACATGCGTG TTCGTTGCCT GCAAAGATTG AGGAGTTCAA 
0361 CGTGTCCATC AACCAAGGTT CGTAAAACAA CATCAAGGGG CGNACAGGAA CAAGGCCANC 
0421 CGACATAGTG TTGTCCAATG AAATTACTGC TGATTGGACA GCTCAACTAC TACCTCAACC 
0481 ATACACAATC CGGTTCAGAA CCCATCGAGG NNNT 
 in silico PCR Fragment
0001 ATGTATCCTG TGAGCTCGCA AAAGAGGTCC TGGACATTCG CCAATGAGGG CCAGCTCATG 
0061 GAGTTCCGCG TGGAGCAGAA CAGCAAGTAC ATCGAGTCGC ACGAGGAGGA GGCGCAGGGT 
0121 CGCGACCTCA ATGAGCACTT TCTCACGTCG GCGGAGGAGC GCCTGT-TGC TGAAGCAGTA 
0181 CGAGATCTAC CTGTTCGATT TCTGCCGCCG CTTCGAACCG ACGATGCCCA AGTGCGTTGT 
0241 GGGCACGGCC T-TCCACTAC TTCAAGCGGT TCTATCTGAA CAACTCCCCC ATGGACTATC 
0301 ACCCCAAGGA GATTCT-AGC CACATGCGTG TTCGTTGCCT GCAAAG-TTG AGGAGTTCAA 
0361 CGTGTCCATC AACCA--GTT CGT-AAACAA CATCAA-GGG CG-ACAGGAA CAAGGCCA-C 
0421 CGACATAGTG TTGTCCAATG -AATTACTGC TGATTGGACA GCTCAACTAC TACCTC-ACC 
0481 ATACACAATC C-GTTCAG-A CCCATCGAGG GTTT 
 Assemble Data

7405R-1.IR_full       1   ATGTATCCTGTGAGCTCGCAAAAGAGGTCCTGGACATTCGCCAATGAGGGCCAGCTCATG 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7405R-1.in silico     1   ATGTATCCTGTGAGCTCGCAAAAGAGGTCCTGGACATTCGCCAATGAGGGCCAGCTCATG 60


7405R-1.IR_full       61  GAGTTCCGCGTGGAGCAGAACAGCAAGTACATCGAGTCGCACGAGGAGGAGGCGCAGGGT 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7405R-1.in silico     61  GAGTTCCGCGTGGAGCAGAACAGCAAGTACATCGAGTCGCACGAGGAGGAGGCGCAGGGT 120


7405R-1.IR_full       121 CGNGACCTCAATGAGCACTTTCTCACGTCGGCGGAGGAGCGCCTGTNTGCTGAAGCAGTA 180
                          || ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||
7405R-1.in silico     121 CGCGACCTCAATGAGCACTTTCTCACGTCGGCGGAGGAGCGCCTGT-TGCTGAAGCAGTA 180


7405R-1.IR_full       181 CGAGATCTACCTGTTCGATTTCTGCCGCCGCTTCGAACCGACGATGCCCAAGTGCGTTGT 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7405R-1.in silico     181 CGAGATCTACCTGTTCGATTTCTGCCGCCGCTTCGAACCGACGATGCCCAAGTGCGTTGT 240


7405R-1.IR_full       241 GGGCACGGCCTNTCCACTACTTCAAGCGGTTCTATCTGAACAACTCCCCCATGGACTATC 300
                          ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||
7405R-1.in silico     241 GGGCACGGCCT-TCCACTACTTCAAGCGGTTCTATCTGAACAACTCCCCCATGGACTATC 300


7405R-1.IR_full       301 ACCCCAAGGAGATTCTAAGCCACATGCGTGTTCGTTGCCTGCAAAGATTGAGGAGTTCAA 360
                          |||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||
7405R-1.in silico     301 ACCCCAAGGAGATTCT-AGCCACATGCGTGTTCGTTGCCTGCAAAG-TTGAGGAGTTCAA 360


7405R-1.IR_full       361 CGTGTCCATCAACCAAGGTTCGTAAAACAACATCAAGGGGCGNACAGGAACAAGGCCANC 420
                          |||||||||||||||  |||||| |||||||||||| ||||| ||||||||||||||| |
7405R-1.in silico     361 CGTGTCCATCAACCA--GTTCGT-AAACAACATCAA-GGGCG-ACAGGAACAAGGCCA-C 420


7405R-1.IR_full       421 CGACATAGTGTTGTCCAATGAAATTACTGCTGATTGGACAGCTCAACTACTACCTCAACC 480
                          |||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||
7405R-1.in silico     421 CGACATAGTGTTGTCCAATG-AATTACTGCTGATTGGACAGCTCAACTACTACCTC-ACC 480


7405R-1.IR_full       481 ATACACAATCCGGTTCAGAACCCATCGAGGNNNT 514
                          ||||||||||| |||||| |||||||||||   |
7405R-1.in silico     481 ATACACAATCC-GTTCAG-ACCCATCGAGGGTTT 514

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_079483.2  CG7405-RA (CycH), mRNA 
0.2   NM_176545.1  CG4620-RA, transcript variant A (unk), mRNA 
0.2   NM_176546.1  CG4620-RB, transcript variant B (unk), mRNA 
0   NM_143083.2  CG10238-RA (CG10238), mRNA 
0   NM_057431.2  CG7171-RA (Uro), mRNA 
0   NM_132660.2  CG1716-RA (CG1716), mRNA 
0   NM_137622.2  CG11788-RA (CG11788), mRNA 
0   NM_175960.3  CG33196-RB (dp), mRNA 
0   NM_132437.1  CG15207-RA (CG15207), mRNA 
0   NM_135471.1  CG13123-RA (CG13123), mRNA 
0   NM_170234.1  CG17383-RC, transcript variant C (CG17383), mRNA 
0   NM_170235.1  CG17383-RD, transcript variant D (CG17383), mRNA 
0   NM_170233.1  CG17383-RA, transcript variant A (CG17383), mRNA 
0   NM_143152.2  CG17383-RB, transcript variant B (CG17383), mRNA 
0   NM_136409.1  CG17002-RB (CG17002), mRNA 
0   NM_140879.1  CG9392-RA (CG9392), mRNA 
0   NM_137058.2  CG12295-RB (stj), mRNA 
0   NM_079817.2  CG1842-RA (Dhc98D), mRNA 
0   NM_058024.3  CG18642-RA (Bem46), mRNA 
0   NM_206235.1  CG13921-RB, transcript variant B (CG13921), mRNA 
0   NM_139399.1  CG13921-RA, transcript variant A (CG13921), mRNA 
0   NM_079617.3  CG7855-RA (timeout), mRNA 
0   NM_138985.2  CG8947-RA (26-29-p), mRNA 
0   NM_137909.2  CG9882-RA (Art7), mRNA 
0   NM_135808.2  CG7110-RB (CG7110), mRNA 
0   NM_135201.1  CG9595-RA (osm-6), mRNA 
0   NM_176711.2  CG1543-RB (Tbh), mRNA 
0   NM_176715.1  CG7033-RC, transcript variant C (CG7033), mRNA 
0   NM_132296.2  CG7033-RA, transcript variant A (CG7033), mRNA 
0   NM_167176.1  CG7033-RB, transcript variant B (CG7033), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.