National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 7404R-3 
 Symbol ERR  Full Name estrogen-related receptor 
 CG No CG7404  Old CG No CG7404 
 Synonyms dERR, CG7404, ERR, NR3B4 
 Accession No (Link to NCBI) NM_168258.1 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
Sinenko SA, Hung T, Moroz T, Tran QM, Sidhu S, Cheney MD, Speck NA, Banerjee U.
Genetic manipulation of AML1-ETO-induced expansion of hematopoietic precursors in a Drosophila model.
Blood (2010) 116(22) 4612-20 [ PubMed ID = 20688956 ] [ RRC reference ]

Nitta Y, Yamazaki D, Sugie A, Hiroi M, Tabata T.
DISCO Interacting Protein 2 regulates axonal bifurcation and guidance of Drosophila mushroom body neurons.
Dev. Biol. (2017) 421(2) 233-244 [ PubMed ID = 27908785 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgCAGCTCCAAGTCAACGGCCAC 
 Primer Seq. 3'
aatctagaggtaccGAACTCGATCCAAGCGCACAC 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 CAGCTCCAAG TCAACGGCCA CGCAGAGTGg cACAAACGGC CTGAAATCCT CGCCCTCGGT 
0061 TTCGCCGGAA AgGNAGCTCT GCAGCTCGAC GACCTCTCTA TCCTGCGATT TGCACAATGT 
0121 ATCCTTAAGC AATGATGGCG ATAGTNTGAA AGGAAGTGGT ACAAGTGGCG GCAATGGCGG 
0181 AGGAGGAGGT GGTGGTACNA GTGGTGGAAA TGCGACCAAT GCGAGTGCCG GAGCTGGATC 
0241 GGGATCCGTC AGGGACGAGC TTCGCCGATT GTGTTTGGTT TGTGGCGATG TGGCCAGTGG 
0301 ATTNCCACTA TGGTGTGGCG AGTTGTGAGG CTTGCAAAGC GTTCTTTAAA CGCACCATCC 
0361 AAGGCAACAT CGAGTACACG TGTCCGGCGA ACAACGAGTG TGAGATTAAC AAGCGGAGAC 
0421 GCAAGGCCTG CCAAgNGTGT CGCTTCCAGA AATGTCTACT AATGGGCATG CTCAAGGAGG 
0481 GTGTGCGCTT GGATCGAGTT C 
 in silico PCR Fragment
0001 CAGCTCCAAG TCAACGGCCA CGCAGAGTGG CACAAACGGC CTGAAATCCT CGCCCTCGGT 
0061 TTCGCCGGAA AGGCAGCTCT GCAGCTCGAC GACCTCTCTA TCCTGCGATT TGCACAATGT 
0121 ATCCTTAAGC AATGATGGCG ATAGTCTGAA AGGAAGTGGT ACAAGTGGCG GCAATGGCGG 
0181 AGGAGGAGGT GGTGGTACGA GTGGTGGAAA TGCGACCAAT GCGAGTGCCG GAGCTGGATC 
0241 GGGATCCGTC AGGGACGAGC TCCGCCGATT GTGTTTGGTT TGTGGCGATG TGGCCAGTGG 
0301 ATT-CCACTA TGGTGTGGCG AGTTGTGAGG CTTGCAAAGC GTTCTTTAAA CGCACCATCC 
0361 AAGGCAACAT CGAGTACACG TGTCCGGCGA ACAACGAGTG TGAGATTAAC AAGCGGAGAC 
0421 GCAAGGCCTG CCAAGCGTGT CGCTTCCAGA AATGTCTACT AATGGGCATG CTCAAGGAGG 
0481 GTGTGCGCTT GGATCGAGTT C 
 Assemble Data

7404R-3.IR_full       1   CAGCTCCAAGTCAACGGCCACGCAGAGTGGCACAAACGGCCTGAAATCCTCGCCCTCGGT 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7404R-3.in silico     1   CAGCTCCAAGTCAACGGCCACGCAGAGTGGCACAAACGGCCTGAAATCCTCGCCCTCGGT 60


7404R-3.IR_full       61  TTCGCCGGAAAGGNAGCTCTGCAGCTCGACGACCTCTCTATCCTGCGATTTGCACAATGT 120
                          ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||
7404R-3.in silico     61  TTCGCCGGAAAGGCAGCTCTGCAGCTCGACGACCTCTCTATCCTGCGATTTGCACAATGT 120


7404R-3.IR_full       121 ATCCTTAAGCAATGATGGCGATAGTNTGAAAGGAAGTGGTACAAGTGGCGGCAATGGCGG 180
                          ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||
7404R-3.in silico     121 ATCCTTAAGCAATGATGGCGATAGTCTGAAAGGAAGTGGTACAAGTGGCGGCAATGGCGG 180


7404R-3.IR_full       181 AGGAGGAGGTGGTGGTACNAGTGGTGGAAATGCGACCAATGCGAGTGCCGGAGCTGGATC 240
                          |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||
7404R-3.in silico     181 AGGAGGAGGTGGTGGTACGAGTGGTGGAAATGCGACCAATGCGAGTGCCGGAGCTGGATC 240


7404R-3.IR_full       241 GGGATCCGTCAGGGACGAGCTTCGCCGATTGTGTTTGGTTTGTGGCGATGTGGCCAGTGG 300
                          ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||
7404R-3.in silico     241 GGGATCCGTCAGGGACGAGCTCCGCCGATTGTGTTTGGTTTGTGGCGATGTGGCCAGTGG 300


7404R-3.IR_full       301 ATTNCCACTATGGTGTGGCGAGTTGTGAGGCTTGCAAAGCGTTCTTTAAACGCACCATCC 360
                          ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7404R-3.in silico     301 ATT-CCACTATGGTGTGGCGAGTTGTGAGGCTTGCAAAGCGTTCTTTAAACGCACCATCC 360


7404R-3.IR_full       361 AAGGCAACATCGAGTACACGTGTCCGGCGAACAACGAGTGTGAGATTAACAAGCGGAGAC 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7404R-3.in silico     361 AAGGCAACATCGAGTACACGTGTCCGGCGAACAACGAGTGTGAGATTAACAAGCGGAGAC 420


7404R-3.IR_full       421 GCAAGGCCTGCCAAGNGTGTCGCTTCCAGAAATGTCTACTAATGGGCATGCTCAAGGAGG 480
                          ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||
7404R-3.in silico     421 GCAAGGCCTGCCAAGCGTGTCGCTTCCAGAAATGTCTACTAATGGGCATGCTCAAGGAGG 480


7404R-3.IR_full       481 GTGTGCGCTTGGATCGAGTTC 501
                          |||||||||||||||||||||
7404R-3.in silico     481 GTGTGCGCTTGGATCGAGTTC 501

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  10  NM_168258.1  CG7404-RA, transcript variant A (ERR), mRNA 
100   482  10  NM_139926.1  CG7404-RB, transcript variant B (ERR), mRNA 
0.62   14  NM_057511.3  CG3936-RA (N), mRNA 
0.41   11  NM_140759.2  CG5546-RA (MED19), mRNA 
0.2   NM_130624.2  CG16903-RA (CG16903), mRNA 
0   NM_132073.1  CG14445-RA (CG14445), mRNA 
0   18  NM_175956.1  CG33003-RA (CG33003), mRNA 
0   36  NM_079093.2  CG9888-RA (Fib), mRNA 
0   12  NM_132976.1  CG5172-RA, transcript variant A (CG5172), mRNA 
0   10  NM_170420.1  CG18741-RA, transcript variant A (DopR2), mRNA 
0   10  NM_079824.2  CG18741-RB, transcript variant B (DopR2), mRNA 
0   20  28  NM_132403.3  CG17255-RA, transcript variant A (CG17255), mRNA 
0   20  28  NM_167231.3  CG17255-RB, transcript variant B (CG17255), mRNA 
0   10  16  NM_135939.2  CG4132-RA (pkaap), mRNA 
0   29  NM_164565.1  CG3399-RC, transcript variant C (capu), mRNA 
0   29  NM_164566.1  CG3399-RD, transcript variant D (capu), mRNA 
0   29  NM_164567.1  CG3399-RB, transcript variant B (capu), mRNA 
0   29  NM_057618.2  CG3399-RA, transcript variant A (capu), mRNA 
0   11  NM_142751.1  CG5778-RA (CG5778), mRNA 
0   13  NM_130506.1  CG13358-RA (CG13358), mRNA 
0   11  NM_136895.2  CG13176-RA (CG13176), mRNA 
0   13  NM_141397.2  CG1021-RB, transcript variant B (CG1021), mRNA 
0   13  NM_169141.1  CG1021-RA, transcript variant A (CG1021), mRNA 
0   NM_205967.1  CG5442-RA, transcript variant A (SC35), mRNA 
0   NM_144355.2  CG5442-RB, transcript variant B (SC35), mRNA 
0   NM_136425.2  CG11107-RA (CG11107), mRNA 
0   11  NM_057860.3  CG3582-RA (U2af38), mRNA 
0   12  26  NM_132412.1  CG9817-RA (CG9817), mRNA 
0   10  22  NM_142622.1  CG4360-RA (CG4360), mRNA 
0   13  NM_137713.2  CG4266-RA (CG4266), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.