National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 7404R-2 
 Symbol ERR  Full Name estrogen-related receptor 
 CG No CG7404  Old CG No CG7404 
 Synonyms dERR, CG7404, ERR, NR3B4 
 Accession No (Link to NCBI) NM_168258.1 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees male lethal 
 Map Viewer
[Please submit your publication]
Sinenko SA, Hung T, Moroz T, Tran QM, Sidhu S, Cheney MD, Speck NA, Banerjee U.
Genetic manipulation of AML1-ETO-induced expansion of hematopoietic precursors in a Drosophila model.
Blood (2010) 116(22) 4612-20 [ PubMed ID = 20688956 ] [ RRC reference ]

Nitta Y, Yamazaki D, Sugie A, Hiroi M, Tabata T.
DISCO Interacting Protein 2 regulates axonal bifurcation and guidance of Drosophila mushroom body neurons.
Dev. Biol. (2017) 421(2) 233-244 [ PubMed ID = 27908785 ] [ RRC reference ]  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     1   CAGCTCCAAGTCAACGGCCACGCAGAGTGGCACAAACGGCCTGAAATCCTCGCCCTCGGT 60

                          ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| silico     61  TTCGCCGGAAAGGCAGCTCTGCAGCTCGACGACCTCTCTATCCTGCGATTTGCACAATGT 120

                          ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| silico     121 ATCCTTAAGCAATGATGGCGATAGTCTGAAAGGAAGTGGTACAAGTGGCGGCAATGGCGG 180

                          |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| silico     181 AGGAGGAGGTGGTGGTACGAGTGGTGGAAATGCGACCAATGCGAGTGCCGGAGCTGGATC 240

                          ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| silico     241 GGGATCCGTCAGGGACGAGCTCCGCCGATTGTGTTTGGTTTGTGGCGATGTGGCCAGTGG 300

                          ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     301 ATT-CCACTATGGTGTGGCGAGTTGTGAGGCTTGCAAAGCGTTCTTTAAACGCACCATCC 360

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     361 AAGGCAACATCGAGTACACGTGTCCGGCGAACAACGAGTGTGAGATTAACAAGCGGAGAC 420

                          ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| silico     421 GCAAGGCCTGCCAAGCGTGTCGCTTCCAGAAATGTCTACTAATGGGCATGCTCAAGGAGG 480

7404R-2.IR_full       481 GTGTGCGCTTGGATCGAGTTC 501
                          ||||||||||||||||||||| silico     481 GTGTGCGCTTGGATCGAGTTC 501

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  10  NM_168258.1  CG7404-RA, transcript variant A (ERR), mRNA 
100   482  10  NM_139926.1  CG7404-RB, transcript variant B (ERR), mRNA 
0.62   14  NM_057511.3  CG3936-RA (N), mRNA 
0.41   11  NM_140759.2  CG5546-RA (MED19), mRNA 
0.2   NM_130624.2  CG16903-RA (CG16903), mRNA 
0   NM_132073.1  CG14445-RA (CG14445), mRNA 
0   18  NM_175956.1  CG33003-RA (CG33003), mRNA 
0   36  NM_079093.2  CG9888-RA (Fib), mRNA 
0   12  NM_132976.1  CG5172-RA, transcript variant A (CG5172), mRNA 
0   10  NM_170420.1  CG18741-RA, transcript variant A (DopR2), mRNA 
0   10  NM_079824.2  CG18741-RB, transcript variant B (DopR2), mRNA 
0   20  28  NM_132403.3  CG17255-RA, transcript variant A (CG17255), mRNA 
0   20  28  NM_167231.3  CG17255-RB, transcript variant B (CG17255), mRNA 
0   10  16  NM_135939.2  CG4132-RA (pkaap), mRNA 
0   29  NM_164565.1  CG3399-RC, transcript variant C (capu), mRNA 
0   29  NM_164566.1  CG3399-RD, transcript variant D (capu), mRNA 
0   29  NM_164567.1  CG3399-RB, transcript variant B (capu), mRNA 
0   29  NM_057618.2  CG3399-RA, transcript variant A (capu), mRNA 
0   11  NM_142751.1  CG5778-RA (CG5778), mRNA 
0   13  NM_130506.1  CG13358-RA (CG13358), mRNA 
0   11  NM_136895.2  CG13176-RA (CG13176), mRNA 
0   13  NM_141397.2  CG1021-RB, transcript variant B (CG1021), mRNA 
0   13  NM_169141.1  CG1021-RA, transcript variant A (CG1021), mRNA 
0   NM_205967.1  CG5442-RA, transcript variant A (SC35), mRNA 
0   NM_144355.2  CG5442-RB, transcript variant B (SC35), mRNA 
0   NM_136425.2  CG11107-RA (CG11107), mRNA 
0   11  NM_057860.3  CG3582-RA (U2af38), mRNA 
0   12  26  NM_132412.1  CG9817-RA (CG9817), mRNA 
0   10  22  NM_142622.1  CG4360-RA (CG4360), mRNA 
0   13  NM_137713.2  CG4266-RA (CG4266), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.