National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 7399R-3 
 Symbol Hn  Full Name Henna 
 CG No CG7399  Old CG No CG7399 
 Synonyms DTPH, TPH, Tph, PAH, Pah, pah, bu, CG7399, Hn 
 Accession No (Link to NCBI) NM_079239.3 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
Leitão-Gonçalves R, Carvalho-Santos Z, Francisco AP, Fioreze GT, Anjos M, Baltazar C, Elias AP, Itskov PM, Piper MDW, Ribeiro C.
Commensal bacteria and essential amino acids control food choice behavior and reproduction.
PLoS Biol (2017) 15(4) e2000862 [ PubMed ID = 28441450 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgTTTTCGCCCAAGGATTCGTCG 
 Primer Seq. 3'
aatctagaggtaccCAGGCATGTGTCTTATACAGC 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 TTTTCGCCCA AGGATTCGTC GTTGTCCAGC GGAGCTTTGG CCAACATTTT GGCCATCTTC 
0061 AAGAAGCATG ACATAAACCT GGTGCATATT GAGTCGCGTT CCTCGCTGCG TGTTCCCGGT 
0121 TATGAGTTTT TCGTGGAGGC CGATGGAAAA TCGGGAGCCT TGGGAAAAGC CATCGAGGAT 
0181 GTGAAGGAGC AGTGTAGCTA CTTTAACATC ATTTCGCGTG ACTACAAGGA TAATGCCACG 
0241 GCNTGTGCCC TGGTTNCCCG CGGCGTATAC GCGATCTGGA TCGTTTCGCC AATCAGATTC 
0301 TGAGCTACGG ATCGGAGCTG GATGCCGATC ATCCTGGTTT TACCGATCCG GAATACCGCA 
0361 AGCGTCGCAA GTACTTCGCC GACATTGCCT ACAACTACAA GCATGGCGAG CCCTTGCCCC 
0421 ATGTGGATTA CACCAAGGAG GAGATCGAGA CCTGGGGCAT TATCTTCAGG AATCTTACGA 
0481 AGCTGTATAA GACACATGCC TG 
 in silico PCR Fragment
0001 TTTTCGCCCA AGGATTCGTC GTTGTCCAGC GGAGCTTTGG CCAACATTTT GGCCATCTTC 
0061 AAGAAGCATG ACATAAACCT GGTGCATATT GAGTCGCGTT CCTCGCTGCG TGTTCCCGGT 
0121 TATGAGTTTT TCGTGGAGGC CGATGGAAAA TCGGGAGCCT TGGGAAAAGC CATCGAGGAT 
0181 GTGAAGGAGC AGTGTAGCTA CTTTAACATC ATTTCGCGTG ACTACAAGGA TAATGCCACG 
0241 GC-TGTGCCC TGGTT-CCCG CGGCGTATAC GCGATCTGGA TCGTTTCGCC AATCAGATTC 
0301 TGAGCTACGG ATCGGAGCTG GATGCCGATC ATCCTGGTTT TACCGATCCG GAATACCGCA 
0361 AGCGTCGCAA GTACTTCGCC GACATTGCCT ACAACTACAA GCATGGCGAG CCCTTGCCCC 
0421 ATGTGGATTA CACCAAGGAG GAGATCGAGA CCTGGGGCAT TATCTTCAGG AATCTTACGA 
0481 AGCTGTATAA GACACATGCC TG 
 Assemble Data

7399R-3.IR_full       1   TTTTCGCCCAAGGATTCGTCGTTGTCCAGCGGAGCTTTGGCCAACATTTTGGCCATCTTC 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7399R-3.in silico     1   TTTTCGCCCAAGGATTCGTCGTTGTCCAGCGGAGCTTTGGCCAACATTTTGGCCATCTTC 60


7399R-3.IR_full       61  AAGAAGCATGACATAAACCTGGTGCATATTGAGTCGCGTTCCTCGCTGCGTGTTCCCGGT 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7399R-3.in silico     61  AAGAAGCATGACATAAACCTGGTGCATATTGAGTCGCGTTCCTCGCTGCGTGTTCCCGGT 120


7399R-3.IR_full       121 TATGAGTTTTTCGTGGAGGCCGATGGAAAATCGGGAGCCTTGGGAAAAGCCATCGAGGAT 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7399R-3.in silico     121 TATGAGTTTTTCGTGGAGGCCGATGGAAAATCGGGAGCCTTGGGAAAAGCCATCGAGGAT 180


7399R-3.IR_full       181 GTGAAGGAGCAGTGTAGCTACTTTAACATCATTTCGCGTGACTACAAGGATAATGCCACG 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7399R-3.in silico     181 GTGAAGGAGCAGTGTAGCTACTTTAACATCATTTCGCGTGACTACAAGGATAATGCCACG 240


7399R-3.IR_full       241 GCNTGTGCCCTGGTTNCCCGCGGCGTATACGCGATCTGGATCGTTTCGCCAATCAGATTC 300
                          || |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||
7399R-3.in silico     241 GC-TGTGCCCTGGTT-CCCGCGGCGTATACGCGATCTGGATCGTTTCGCCAATCAGATTC 300


7399R-3.IR_full       301 TGAGCTACGGATCGGAGCTGGATGCCGATCATCCTGGTTTTACCGATCCGGAATACCGCA 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7399R-3.in silico     301 TGAGCTACGGATCGGAGCTGGATGCCGATCATCCTGGTTTTACCGATCCGGAATACCGCA 360


7399R-3.IR_full       361 AGCGTCGCAAGTACTTCGCCGACATTGCCTACAACTACAAGCATGGCGAGCCCTTGCCCC 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7399R-3.in silico     361 AGCGTCGCAAGTACTTCGCCGACATTGCCTACAACTACAAGCATGGCGAGCCCTTGCCCC 420


7399R-3.IR_full       421 ATGTGGATTACACCAAGGAGGAGATCGAGACCTGGGGCATTATCTTCAGGAATCTTACGA 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7399R-3.in silico     421 ATGTGGATTACACCAAGGAGGAGATCGAGACCTGGGGCATTATCTTCAGGAATCTTACGA 480


7399R-3.IR_full       481 AGCTGTATAAGACACATGCCTG 502
                          ||||||||||||||||||||||
7399R-3.in silico     481 AGCTGTATAAGACACATGCCTG 502

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_079239.3  CG7399-RA, transcript variant A (Hn), mRNA 
100   482  NM_001014573.1  CG7399-RB, transcript variant B (Hn), mRNA 
0   NM_141805.1  CG5207-RA (scpr-A), mRNA 
0   NM_132335.2  CG12139-RB (CG12139), mRNA 
0   NM_001014571.1  CG33556-RA (form3), mRNA 
0   NM_168869.1  CG4268-RC, transcript variant C (Pitslre), mRNA 
0   NM_140994.2  CG4268-RA, transcript variant A (Pitslre), mRNA 
0   NM_170355.2  CG12877-RB, transcript variant B (CG12877), mRNA 
0   NM_143327.2  CG12877-RA, transcript variant A (CG12877), mRNA 
0   NM_001038984.1  CG12877-RC, transcript variant C (CG12877), mRNA 
0   NM_176462.1  CG31116-RD, transcript variant D (CG31116), mRNA 
0   NM_169432.2  CG31116-RA, transcript variant A (CG31116), mRNA 
0   NM_169431.2  CG31116-RC, transcript variant C (CG31116), mRNA 
0   NM_137402.2  CG4966-RA, transcript variant A (CG4966), mRNA 
0   NM_166245.1  CG4966-RB, transcript variant B (CG4966), mRNA 
0   NM_057550.3  CG10118-RB, transcript variant B (ple), mRNA 
0   NM_057549.2  CG10118-RA, transcript variant A (ple), mRNA 
0   NM_143497.2  CG7896-RA (CG7896), mRNA 
0   10  NM_001043070.1  CG34146-RA (brp), mRNA 
0   NM_167001.1  CG4944-RA, transcript variant A (cib), mRNA 
0   NM_080326.4  CG4944-RB, transcript variant B (cib), mRNA 
0   NM_134869.2  CG2964-RA (CG2964), mRNA 
0   NM_167002.1  CG4944-RC, transcript variant C (cib), mRNA 
0   NM_206091.1  CG7734-RD, transcript variant D (shn), mRNA 
0   NM_057375.3  CG7734-RA, transcript variant A (shn), mRNA 
0   NM_134279.2  CG7734-RB, transcript variant B (shn), mRNA 
0   NM_057376.2  CG7734-RC, transcript variant C (shn), mRNA 
0   NM_001043147.1  CG32178-RB, transcript variant B (Msi), mRNA 
0   NM_080281.3  CG32178-RA, transcript variant A (Msi), mRNA 
0   NM_001043148.1  CG32178-RC, transcript variant C (Msi), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.