National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 7393R-1 
 Symbol p38b  Full Name p38b 
 CG No CG7393  Old CG No CG7393 
 Synonyms p38b, p38beta, p38, Dp38, D-p38, D-p38b, p38 beta, p38B, CG7393, p38 MAPK, BG:DS00797.3, 186F5S, anon-sts23, Mpk34C, ESTS:186F5S, Dm p38b 
 Accession No (Link to NCBI) NM_058013.3 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees larval lethal 
 Map Viewer
[Please submit your publication]
Sun Y, Zhang D, Li C, Huang J, Li W, Qiu Y, Mao A, Zhou M, Xue L.
Lic regulates JNK-mediated cell death in Drosophila.
Cell Prolif. (2019) e12593 [ PubMed ID = 30847993 ] [ RRC reference ]

Gonda RL, Garlena RA, Stronach B.
Drosophila heat shock response requires the JNK pathway and phosphorylation of mixed lineage kinase at a conserved serine-proline motif.
PLoS ONE (2012) 7(7) e42369 [ PubMed ID = 22848763 ] [ RRC reference ]

Sekine Y, Takagahara S, Hatanaka R, Watanabe T, Oguchi H, Noguchi T, Naguro I, Kobayashi K, Tsunoda M, Funatsu T, Nomura H, Toyoda T, Matsuki N, Kuranaga E, Miura M, Takeda K, Ichijo H.
p38 MAPKs regulate the expression of genes in the dopamine synthesis pathway through phosphorylation of NR4A nuclear receptors.
J. Cell. Sci. (2011) 124(Pt 17) 3006-16 [ PubMed ID = 21878507 ] [ RRC reference ]

Hosono C, Matsuda R, Adryan B, Samakovlis C.
Transient junction anisotropies orient annular cell polarization in the Drosophila airway tubes.
Nat. Cell Biol. (2015) 17(12) 1569-76 [ PubMed ID = 26551273 ] [ RRC reference ]

Umetsu D, Dunst S, Dahmann C.
An RNA interference screen for genes required to shape the anteroposterior compartment boundary in Drosophila identifies the Eph receptor.
PLoS ONE (2014) 9(12) e114340 [ PubMed ID = 25473846 ] [ RRC reference ]

Tiwari P, Kumar A, Das RN, Malhotra V, VijayRaghavan K.
A Tendon Cell Specific RNAi Screen Reveals Novel Candidates Essential for Muscle Tendon Interaction.
PLoS ONE (2015) 10(10) e0140976 [ PubMed ID = 26488612 ] [ RRC reference ]  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     1   GCCAAATTCTACAAGCTGGACATCAATCGCACCGAGTGGGAAATCCCGGAAACATACCAG 60

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     61  AACCTGCAACCCGTGGGTCAGGGTGCCTACGGCCAGGTCTGCAAGGCCGTGGTCCGCGGA 120

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     121 ACCAGCACGAAGGTGGCCATCAAGAAGCTTGCCAGGCCCTTCCAGTCGGCGGTCCATGCG 180

                          ||||| ||||||||||||||||||||| |||||||||||||||||||||||||||||||| silico     181 AAGCGCACCTATCGGGAACTGCGGCTGCTGAAGCACATGGATCACGAGAACGTTATTGGT 240

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     241 CTGCTGGATGTCTTTCATCCAGGACAGCCCGCCGATTCGCTGGATCAGTTCCAGCAAGTG 300

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     301 TACATGGTGACCCACTTGATGGACGCCGATCTGAACAACATAATACGCACGCAGAAACTG 360

                          ||||||||||||||||||||||||||||||||||||||||||||||||   ||||||||| silico     361 TCTGATGATCATGTCCAGTTTCTGGTCTACCAAATCCTGCGCGGTCTGAAGTACATCCAC 420

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| silico     421 AGCGCTGGGGTCATCCATCGTGATCTAAAGCCATCGAACATTGCGGTAAACGAGGA-CTG 480

7393R-1.IR_full       481 TGAGCTTCGCATCCTGGGATTT 502
                          ||||||||||||||| |||||| silico     481 TGAGCTTCGCATCCT-GGATTT 502

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_058013.3  CG7393-RA (p38b), mRNA 
0.2   NM_137810.1  CG3290-RA (CG3290), mRNA 
0   21  48  95  NM_170126.2  CG5475-RB, transcript variant B (Mpk2), mRNA 
0   21  48  95  NM_057815.3  CG5475-RA, transcript variant A (Mpk2), mRNA 
0   12  34  NM_206554.1  CG33338-RA (p38c), mRNA 
0   NM_142727.1  CG6800-RA (CG6800), mRNA 
0   NM_176581.2  CG33204-RA (CG33204), mRNA 
0   NM_166760.1  CG1495-RB, transcript variant B (CaMKI), mRNA 
0   NM_166761.1  CG1495-RC, transcript variant C (CaMKI), mRNA 
0   NM_166759.1  CG1495-RA, transcript variant A (CaMKI), mRNA 
0   NM_166762.1  CG1495-RE, transcript variant E (CaMKI), mRNA 
0   NM_079883.2  CG1495-RG, transcript variant G (CaMKI), mRNA 
0   NM_166764.1  CG1495-RH, transcript variant H (CaMKI), mRNA 
0   NM_166763.1  CG1495-RD, transcript variant D (CaMKI), mRNA 
0   11  NM_166415.1  CG3216-RB, transcript variant B (CG3216), mRNA 
0   11  NM_137688.1  CG3216-RA, transcript variant A (CG3216), mRNA 
0   NM_165298.1  CG10237-RC, transcript variant C (CG10237), mRNA 
0   NM_136123.2  CG10237-RB, transcript variant B (CG10237), mRNA 
0   NM_165299.1  CG10237-RA, transcript variant A (CG10237), mRNA 
0   NM_167082.2  CG4095-RA (CG4095), mRNA 
0   15  NM_137515.1  CG15072-RA (CG15072), mRNA 
0   NM_140580.1  CG5414-RA (CG5414), mRNA 
0   NM_170365.1  CG14066-RC, transcript variant C (larp), mRNA 
0   NM_170366.1  CG14066-RB, transcript variant B (larp), mRNA 
0   NM_080259.1  CG14066-RA, transcript variant A (larp), mRNA 
0   NM_137811.2  CG3264-RA (CG3264), mRNA 
0   NM_134904.2  CG3523-RA (CG3523), mRNA 
0   NM_165970.1  CG4062-RB, transcript variant B (Aats-val), mRNA 
0   NM_080099.2  CG4062-RA, transcript variant A (Aats-val), mRNA 
0   NR_002550.1  CR33655, miscRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.