National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 7356R-2 
 Symbol CG7356  Full Name CG7356 
 CG No CG7356  Old CG No CG7356 
 Synonyms CG7356 
 Accession No (Link to NCBI) NM_135330.1 
 Inserted Chr.
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
Sekihara S, Shibata T, Hyakkendani M, Kawabata SI.
RNA interference directed against the Transglutaminase gene triggers dysbiosis of gut microbiota in Drosophila.
J. Biol. Chem. (2016) [ PubMed ID = 27760824 ] [ RRC reference ]

Shibata T, Maki K, Hadano J, Fujikawa T, Kitazaki K, Koshiba T, Kawabata S.
Crosslinking of a Peritrophic Matrix Protein Protects Gut Epithelia from Bacterial Exotoxins.
PLoS Pathog. (2015) 11(10) e1005244 [ PubMed ID = 26506243 ] [ RRC reference ]

Álvarez-Fernández C, Tamirisa S, Prada F, Chernomoretz A, Podhajcer O, Blanco E, Martín-Blanco E.
Identification and functional analysis of healing regulators in Drosophila.
PLoS Genet. (2015) 11(2) e1004965 [ PubMed ID = 25647511 ] [ RRC reference ]

Shibata T, Sekihara S, Fujikawa T, Miyaji R, Maki K, Ishihara T, Koshiba T, Kawabata S.
Transglutaminase-catalyzed protein-protein cross-linking suppresses the activity of the NF-κB-like transcription factor relish.
Sci Signal (2013) 6(285) ra61 [ PubMed ID = 23882120 ] [ RRC reference ]

Lesch C, Jo J, Wu Y, Fish GS, Galko MJ.
A targeted UAS-RNAi screen in Drosophila larvae identifies wound closure genes regulating distinct cellular processes.
Genetics (2010) 186(3) 943-57 [ PubMed ID = 20813879 ] [ RRC reference ]

Wang Z, Wilhelmsson C, Hyrsl P, Loof TG, Dobes P, Klupp M, Loseva O, Mörgelin M, Iklé J, Cripps RM, Herwald H, Theopold U.
Pathogen entrapment by transglutaminase--a conserved early innate immune mechanism.
PLoS Pathog. (2010) 6(2) e1000763 [ PubMed ID = 20169185 ] [ RRC reference ]

Shibata T, Ariki S, Shinzawa N, Miyaji R, Suyama H, Sako M, Inomata N, Koshiba T, Kanuka H, Kawabata S.
Protein crosslinking by transglutaminase controls cuticle morphogenesis in Drosophila.
PLoS ONE (2010) 5(10) e13477 [ PubMed ID = 20976106 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgGGCATTCCACAAGGCGACAAA 
 Primer Seq. 3'
aatctagaggtaccTCCGGACACCAGGGATTAAAG 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 GGNATTCCAC AAGGCGACAA AACAGATGGC GCCAGCTCAN GCAGTATTGG GCGTTTTTAA 
0061 GGTCGATCTG TGCCTGGAGG ACAATCCATG AGGAGCACCA TACGAGTCCA CTTCTATGCG 
0121 GCAGCTGCCA AGGAAGCGTT GGTCGTGCGA CGAGGAGAAC CCTTCCGGCT GAAGATCCAC 
0181 TTCAATCGAG ACTACAGTCC CAGCAAGGAT GCCATCAGTT TCATTTTCAC AGTAGCGGAT 
0241 GACACCAAGC CGAGTCCCGG TCATGGAACA CTCAATGCCC TGGTGCCGCA CGATGGCATC 
0301 GATTATCTGG GCGACACTTT GGAATGGGGA GCCGGCATCG AATCGCATGA GGGTCAAACG 
0361 CTTACGGTGC TAATCAAGCC ACCATCCACC TGTCCCGTAA CGGAATGGAA ACTGGACATC 
0421 GACACGAAGC TGCTGGGAGA TGGATCGCGA AGCTANTCCC CTGCCGTTGC CCATCTATGT 
0481 ACTCTTTAAT CCCTGGTGTC CGGA 
 in silico PCR Fragment
0001 GGCATTCCAC AAGGCGACAA AACAGATGGC GCCAGCTCA- GCAGTATTGG GCGTTTTGAA 
0061 GGTCGATCTG TGCCTGGAGG ACAA-CCATG AGGAGCACCA TACGAGT-CA CTTCTATGCG 
0121 GCAGCTGCCA AGGAAGCGTT GGTCGTGCGA CGAGGAGAAC CCTTCCGGCT GAAGATCCAC 
0181 TTCAATCGAG ACTACAGTCC CAGCAAGGAT GCCATCAGTT TCATTTTCAC AGTAGCGGAT 
0241 GACACCAAGC CGAGTCCCGG TCATGGAACA CTCAATGCCC TGGTGCCGCA CGATGGCATC 
0301 GATTATCTGG GCGACACTTT GGAATGGGGA GCCGGCATCG AATCGCATGA GGGTCAAACG 
0361 CTTACGGTGC TAATCAAGCC ACCATCCACC TGTCCCGTAA CGGAATGGAA ACTGGACATC 
0421 GACACGAAGC TGCTGGGCGA TGGATCGCGA AGCTA-TCCC CTGCCGTTGC CCATCTATGT 
0481 ACTCTTTAAT CCCTGGTGTC CGGA 
 Assemble Data

7356R-2.IR_full       1   GGNATTCCACAAGGCGACAAAACAGATGGCGCCAGCTCANGCAGTATTGGGCGTTTTTAA 60
                          || |||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||
7356R-2.in silico     1   GGCATTCCACAAGGCGACAAAACAGATGGCGCCAGCTCA-GCAGTATTGGGCGTTTTGAA 60


7356R-2.IR_full       61  GGTCGATCTGTGCCTGGAGGACAATCCATGAGGAGCACCATACGAGTCCACTTCTATGCG 120
                          |||||||||||||||||||||||| |||||||||||||||||||||| ||||||||||||
7356R-2.in silico     61  GGTCGATCTGTGCCTGGAGGACAA-CCATGAGGAGCACCATACGAGT-CACTTCTATGCG 120


7356R-2.IR_full       121 GCAGCTGCCAAGGAAGCGTTGGTCGTGCGACGAGGAGAACCCTTCCGGCTGAAGATCCAC 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7356R-2.in silico     121 GCAGCTGCCAAGGAAGCGTTGGTCGTGCGACGAGGAGAACCCTTCCGGCTGAAGATCCAC 180


7356R-2.IR_full       181 TTCAATCGAGACTACAGTCCCAGCAAGGATGCCATCAGTTTCATTTTCACAGTAGCGGAT 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7356R-2.in silico     181 TTCAATCGAGACTACAGTCCCAGCAAGGATGCCATCAGTTTCATTTTCACAGTAGCGGAT 240


7356R-2.IR_full       241 GACACCAAGCCGAGTCCCGGTCATGGAACACTCAATGCCCTGGTGCCGCACGATGGCATC 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7356R-2.in silico     241 GACACCAAGCCGAGTCCCGGTCATGGAACACTCAATGCCCTGGTGCCGCACGATGGCATC 300


7356R-2.IR_full       301 GATTATCTGGGCGACACTTTGGAATGGGGAGCCGGCATCGAATCGCATGAGGGTCAAACG 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7356R-2.in silico     301 GATTATCTGGGCGACACTTTGGAATGGGGAGCCGGCATCGAATCGCATGAGGGTCAAACG 360


7356R-2.IR_full       361 CTTACGGTGCTAATCAAGCCACCATCCACCTGTCCCGTAACGGAATGGAAACTGGACATC 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7356R-2.in silico     361 CTTACGGTGCTAATCAAGCCACCATCCACCTGTCCCGTAACGGAATGGAAACTGGACATC 420


7356R-2.IR_full       421 GACACGAAGCTGCTGGGAGATGGATCGCGAAGCTANTCCCCTGCCGTTGCCCATCTATGT 480
                          ||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||
7356R-2.in silico     421 GACACGAAGCTGCTGGGCGATGGATCGCGAAGCTA-TCCCCTGCCGTTGCCCATCTATGT 480


7356R-2.IR_full       481 ACTCTTTAATCCCTGGTGTCCGGA 504
                          ||||||||||||||||||||||||
7356R-2.in silico     481 ACTCTTTAATCCCTGGTGTCCGGA 504

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_135330.1  CG7356-RA, transcript variant A (CG7356), mRNA 
95.22   459  NM_164778.1  CG7356-RB, transcript variant B (CG7356), mRNA 
0   NM_169501.1  CG8644-RA (Osi22), mRNA 
0   NM_079275.2  CG4463-RA (Hsp23), mRNA 
0   NM_132684.1  CG11158-RA (CG11158), mRNA 
0   NM_132412.1  CG9817-RA (CG9817), mRNA 
0   NM_142954.3  CG6057-RA (SMC1), mRNA 
0   NM_080365.2  CG4894-RB, transcript variant B (Ca-alpha1D), mRNA 
0   NM_165146.1  CG4894-RC, transcript variant C (Ca-alpha1D), mRNA 
0   NM_134429.2  CG4894-RA, transcript variant A (Ca-alpha1D), mRNA 
0   NM_165147.1  CG4894-RD, transcript variant D (Ca-alpha1D), mRNA 
0   NM_079768.2  CG6238-RA, transcript variant A (ssh), mRNA 
0   NM_170184.1  CG6238-RB, transcript variant B (ssh), mRNA 
0   NM_165664.1  CG8026-RA, transcript variant A (CG8026), mRNA 
0   NM_136624.2  CG8026-RB, transcript variant B (CG8026), mRNA 
0   13  NM_206502.1  CG3937-RD, transcript variant D (cher), mRNA 
0   12  NM_079659.2  CG3937-RA, transcript variant A (cher), mRNA 
0   11  NM_169746.1  CG3937-RB, transcript variant B (cher), mRNA 
0   11  NM_169747.1  CG3937-RC, transcript variant C (cher), mRNA 
0   NM_057358.3  CG3180-RA (RpII140), mRNA 
0   NM_078670.2  CG7092-RA (Dhc16F), mRNA 
0   NM_080025.1  CG11387-RA, transcript variant A (ct), mRNA 
0   NM_132438.1  CG11203-RA (CG11203), mRNA 
0   NM_137259.2  CG15707-RA (CG15707), mRNA 
0   NM_139612.1  CG1308-RA (CG1308), mRNA 
0   NM_142538.1  CG5237-RA (CG5237), mRNA 
0   NM_175960.3  CG33196-RB (dp), mRNA 
0   NM_140125.1  CG6640-RA, transcript variant A (CG6640), mRNA 
0   NM_142283.2  CG17565-RA (CG17565), mRNA 
0   NM_143191.2  CG14546-RA (CG14546), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.