National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 7356R-1 
 Symbol CG7356  Full Name CG7356 
 CG No CG7356  Old CG No CG7356 
 Synonyms CG7356 
 Accession No (Link to NCBI) NM_135330.1 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
[Please submit your publication]
Sekihara S, Shibata T, Hyakkendani M, Kawabata SI.
RNA interference directed against the Transglutaminase gene triggers dysbiosis of gut microbiota in Drosophila.
J. Biol. Chem. (2016) [ PubMed ID = 27760824 ] [ RRC reference ]

Shibata T, Maki K, Hadano J, Fujikawa T, Kitazaki K, Koshiba T, Kawabata S.
Crosslinking of a Peritrophic Matrix Protein Protects Gut Epithelia from Bacterial Exotoxins.
PLoS Pathog. (2015) 11(10) e1005244 [ PubMed ID = 26506243 ] [ RRC reference ]

Min B, Kwon YC, Choe KM, Chung KC.
PINK1 phosphorylates transglutaminase 2 and blocks its proteasomal degradation.
J. Neurosci. Res. (2015) 93(5) 722-35 [ PubMed ID = 25557247 ] [ RRC reference ]

Álvarez-Fernández C, Tamirisa S, Prada F, Chernomoretz A, Podhajcer O, Blanco E, Martín-Blanco E.
Identification and functional analysis of healing regulators in Drosophila.
PLoS Genet. (2015) 11(2) e1004965 [ PubMed ID = 25647511 ] [ RRC reference ]

Shibata T, Sekihara S, Fujikawa T, Miyaji R, Maki K, Ishihara T, Koshiba T, Kawabata S.
Transglutaminase-catalyzed protein-protein cross-linking suppresses the activity of the NF-κB-like transcription factor relish.
Sci Signal (2013) 6(285) ra61 [ PubMed ID = 23882120 ] [ RRC reference ]

Lesch C, Jo J, Wu Y, Fish GS, Galko MJ.
A targeted UAS-RNAi screen in Drosophila larvae identifies wound closure genes regulating distinct cellular processes.
Genetics (2010) 186(3) 943-57 [ PubMed ID = 20813879 ] [ RRC reference ]

Shibata T, Ariki S, Shinzawa N, Miyaji R, Suyama H, Sako M, Inomata N, Koshiba T, Kanuka H, Kawabata S.
Protein crosslinking by transglutaminase controls cuticle morphogenesis in Drosophila.
PLoS ONE (2010) 5(10) e13477 [ PubMed ID = 20976106 ] [ RRC reference ]

Umemori M, Habara O, Iwata T, Maeda K, Nishinoue K, Okabe A, Takemura M, Takahashi K, Saigo K, Ueda R, Adachi-Yamada T.
RNAi-mediated knockdown showing impaired cell survival in Drosophila wing imaginal disc.
Gene Regul Syst Bio (2009) 3 11-20 [ PubMed ID = 19838331 ] [ RRC reference ]  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                          || |||||||||||||||||||||||||||||||||||| ||||||||||||||||| || silico     1   GGCATTCCACAAGGCGACAAAACAGATGGCGCCAGCTCA-GCAGTATTGGGCGTTTTGAA 60

                          |||||||||||||||||||||||| |||||||||||||||||||||| |||||||||||| silico     61  GGTCGATCTGTGCCTGGAGGACAA-CCATGAGGAGCACCATACGAGT-CACTTCTATGCG 120

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     121 GCAGCTGCCAAGGAAGCGTTGGTCGTGCGACGAGGAGAACCCTTCCGGCTGAAGATCCAC 180

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     181 TTCAATCGAGACTACAGTCCCAGCAAGGATGCCATCAGTTTCATTTTCACAGTAGCGGAT 240

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     241 GACACCAAGCCGAGTCCCGGTCATGGAACACTCAATGCCCTGGTGCCGCACGATGGCATC 300

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     301 GATTATCTGGGCGACACTTTGGAATGGGGAGCCGGCATCGAATCGCATGAGGGTCAAACG 360

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     361 CTTACGGTGCTAATCAAGCCACCATCCACCTGTCCCGTAACGGAATGGAAACTGGACATC 420

                          ||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||| silico     421 GACACGAAGCTGCTGGGCGATGGATCGCGAAGCTA-TCCCCTGCCGTTGCCCATCTATGT 480

7356R-1.IR_full       481 ACTCTTTAATCCCTGGTGTCCGGA 504
                          |||||||||||||||||||||||| silico     481 ACTCTTTAATCCCTGGTGTCCGGA 504

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_135330.1  CG7356-RA, transcript variant A (CG7356), mRNA 
95.22   459  NM_164778.1  CG7356-RB, transcript variant B (CG7356), mRNA 
0   NM_169501.1  CG8644-RA (Osi22), mRNA 
0   NM_079275.2  CG4463-RA (Hsp23), mRNA 
0   NM_132684.1  CG11158-RA (CG11158), mRNA 
0   NM_132412.1  CG9817-RA (CG9817), mRNA 
0   NM_142954.3  CG6057-RA (SMC1), mRNA 
0   NM_080365.2  CG4894-RB, transcript variant B (Ca-alpha1D), mRNA 
0   NM_165146.1  CG4894-RC, transcript variant C (Ca-alpha1D), mRNA 
0   NM_134429.2  CG4894-RA, transcript variant A (Ca-alpha1D), mRNA 
0   NM_165147.1  CG4894-RD, transcript variant D (Ca-alpha1D), mRNA 
0   NM_079768.2  CG6238-RA, transcript variant A (ssh), mRNA 
0   NM_170184.1  CG6238-RB, transcript variant B (ssh), mRNA 
0   NM_165664.1  CG8026-RA, transcript variant A (CG8026), mRNA 
0   NM_136624.2  CG8026-RB, transcript variant B (CG8026), mRNA 
0   13  NM_206502.1  CG3937-RD, transcript variant D (cher), mRNA 
0   12  NM_079659.2  CG3937-RA, transcript variant A (cher), mRNA 
0   11  NM_169746.1  CG3937-RB, transcript variant B (cher), mRNA 
0   11  NM_169747.1  CG3937-RC, transcript variant C (cher), mRNA 
0   NM_057358.3  CG3180-RA (RpII140), mRNA 
0   NM_078670.2  CG7092-RA (Dhc16F), mRNA 
0   NM_080025.1  CG11387-RA, transcript variant A (ct), mRNA 
0   NM_132438.1  CG11203-RA (CG11203), mRNA 
0   NM_137259.2  CG15707-RA (CG15707), mRNA 
0   NM_139612.1  CG1308-RA (CG1308), mRNA 
0   NM_142538.1  CG5237-RA (CG5237), mRNA 
0   NM_175960.3  CG33196-RB (dp), mRNA 
0   NM_140125.1  CG6640-RA, transcript variant A (CG6640), mRNA 
0   NM_142283.2  CG17565-RA (CG17565), mRNA 
0   NM_143191.2  CG14546-RA (CG14546), mRNA 
 Wing Disc
JNK signal
Caspase-3 signal
Dcompartment   Penetrance

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.