National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 7297R-3 
 Symbol pgant8  Full Name polypeptide GalNAc transferase 8 
 CG No CG7297  Old CG No CG7297 
 Synonyms CG7297, pgant8 
 Accession No (Link to NCBI)  
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
[Please submit your publication]
Yamamoto-Hino M, Yoshida H, Ichimiya T, Sakamura S, Maeda M, Kimura Y, Sasaki N, Aoki-Kinoshita KF, Kinoshita-Toyoda A, Toyoda H, Ueda R, Nishihara S, Goto S.
Phenotype-based clustering of glycosylation-related genes by RNAi-mediated gene silencing.
Genes Cells (2015) 20(6) 521-42 [ PubMed ID = 25940448 ] [ RRC reference ]  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                          | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     1   GGACATTTGGCGGCACAAGAAGAAGGTGTTGCCGCTGCTACTGCTAATGGCCATCGGCAG 60

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     61  TATTATCTACTATCTATATACCCTGAAATTGGAGGGGGAGCGTGATGAAAGTGCAACTTC 120

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     121 GACAACTTCTCGCTTGGAGCGTGACATAAGAGATCTGCAAGCGGTCTTCGAGTCGGAGGT 180

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     181 CATACCGGATCTGGGAGCTTTGGGTCGCCCGGCAAGGGGTAATTGGACTGAGGAGCAGCT 240

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     241 GGAGGCCATCGCCAAAAGTCAGCGGGAAACGGGTTACAATGCTTGGCTCTCCAAGCGCAT 300

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     301 CTCACCTGAGCGATCGCTCTACGATATGCGACATCGCAGCTGCAAAAAGCTCAAGTACCC 360

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     361 GATGGAAAAGCTCCCATCAGTCAGTGTGGTGATAACGTATCACAATGAGGAGGCAAGCGT 420

                          |||||| |||   |||||||||||||||||||| ||||||||||| |||||||||||||| silico     421 GCTGCTTCGAACGCTTAGCAGCTTGAGGAGCCGAACTCCGATCCAGCTGCTTCGAGAGGT 480

7297R-3.IR full       481 TATCCTGGTGGACGACGGGA 500
                          |||||||||||||||||||| silico     481 TATCCTGGTGGACGACGGGA 500

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100  482  NM_140543.2  polypeptide GalNAc transferase 8 CG7297-RA (pgant8), mRNA 
NM_136422.2  CG1845-RA (CG1845), mRNA 
NM_140296.2  CG5642-RA (CG5642), mRNA 
NM_078675.3  ariadne CG5659-RA, transcript variant A (ari-1), mRNA 
NM_206777.1  ariadne CG5659-RC, transcript variant C (ari-1), mRNA 
NM_167610.3  ariadne CG5659-RB, transcript variant B (ari-1), mRNA 
NM_080033.2  dappled CG1624-RC, transcript variant C (dpld), mRNA 
NM_165534.1  dappled CG1624-RB, transcript variant B (dpld), mRNA 
NM_165533.1  dappled CG1624-RA, transcript variant A (dpld), mRNA 
NM_001042873.1  polypeptide GalNAc transferase 5 CG31651-RB, transcript variant B (pgant5), mRNA 
NM_135062.3  polypeptide GalNAc transferase 5 CG31651-RA, transcript variant A (pgant5), mRNA 
NM_079725.2  Neurexin 1 CG7050-RA (Nrx-1), mRNA 
26  NM_080364.3  bunched CG5461-RA, transcript variant A (bun), mRNA 
26  NM_001042894.1  bunched CG5461-RF, transcript variant F (bun), mRNA 
14  NM_166962.1  dunce CG32498-RC, transcript variant C (dnc), mRNA 
14  NM_166964.1  dunce CG32498-RD, transcript variant D (dnc), mRNA 
14  NM_166963.1  dunce CG32498-RK, transcript variant K (dnc), mRNA 
14  NM_166965.1  dunce CG32498-RJ, transcript variant J (dnc), mRNA 
14  NM_166961.1  dunce CG32498-RI, transcript variant I (dnc), mRNA 
NM_206222.1  rhinoceros CG7036-RB, transcript variant B (rno), mRNA 
NM_138163.1  rhinoceros CG7036-RA, transcript variant A (rno), mRNA 
19  NM_140424.1  CG9007-RA (CG9007), mRNA 
10  NM_205986.1  nicotinic Acetylcholine Receptor alpha 34E CG32975-RB, transcript variant B (nAcRalpha-34E), mRNA 
10  NM_176035.2  nicotinic Acetylcholine Receptor alpha 34E CG32975-RA, transcript variant A (nAcRalpha-34E), mRNA 
10  NM_205985.1  nicotinic Acetylcholine Receptor alpha 34E CG32975-RC, transcript variant C (nAcRalpha-34E), mRNA 
NM_142444.1  CG18599-RA (CG18599), mRNA 
19  NM_140090.1  CG16711-RA, transcript variant A (CG16711), mRNA 
19  NM_168361.1  CG16711-RB, transcript variant B (CG16711), mRNA 
15  NM_132538.1  CG15737-RA (CG15737), mRNA 
NM_168448.1  CG32082-RA (CG32082), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.