National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 7288R-1 
 Symbol CG7288  Full Name CG7288 
 CG No CG7288  Old CG No CG7288 
 Synonyms CG7288 
 Accession No (Link to NCBI) NM_133106.2 
 Inserted Chr. lll 
 Insertional Mutation  lethal 
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Fernández-Espartero CH, Rizzo A, Fulford AD, Falo-Sanjuan J, Goutte-Gattat D, Ribeiro PS.
Prp8 regulates oncogene-induced hyperplastic growth in Drosophila.
Development (2018) 145(22) [ PubMed ID = 30333215 ] [ RRC reference ]

Zhang J, Liu M, Su Y, Du J, Zhu AJ.
A targeted in vivo RNAi screen reveals deubiquitinases as new regulators of Notch signaling.
G3 (Bethesda) (2012) 2(12) 1563-75 [ PubMed ID = 23275879 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgTGGAGAAGACGCCGGCAAATC 
 Primer Seq. 3'
aatctagaggtaccGACGTGGGAGAGTGCATGCAG 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 TGGAGAAGAC GCCGGCAAAT CCCGTCGAAG AGGATGAGAC GCCCTCCGTG TTCAATCCGA 
0061 AGTACAGGGT GTGTCCCTAC TTGGACACCA TCAACCGTAA CCTGCTGGAT TTCGATTTCG 
0121 AGAAGCTTTG CTCCATTTCG CTGACGAGGA TCAATGTTTA TGCCTGCCTG GTGTGCGGCA 
0181 AGTACTTCCA GGGACGTGGC ACCAACACCC ACGCCTACAC ACATTCCGTG GGCGAGGCTC 
0241 ATCACGTGTT CCTCAATCTG CACACGCTGC GATTCTACTG CCTGCCGGAT AATTACGAGA 
0301 TCATCGACTC CTCGTTGGAC GATATCAAAT ACGTGCTAAA TCCAACGTTC ACACGCCAGG 
0361 AGATCAGCAA GTTGGATCAG TTACAGCCGA AGCATTCGCG ANACCGTGGA CGGTGTTCTG 
0421 TACTTACCCG GCGTCGTGGG TTTGAACAAC ATCAAAGCGA ACGACTACTG CAATGTGGTG 
0481 CTGCATGCAC TCTCCCACGT C 
 in silico PCR Fragment
0001 TGGAGAAGAC GCCGGCAAAT CCCGTCGAAG AGGATGAGAC GCCCTCCGTG TTCAATCCGA 
0061 AGTACAGGGT GTGTCCCTAC TTGGACACCA TCAACCGTAA CCTGCTGGAT TTCGATTTCG 
0121 AGAAGCTTTG CTCCATTTCG CTGACGAGGA TCAATGTTTA TGCCTGCCTG GTGTGCGGCA 
0181 AGTACTTCCA GGGACGTGGC ACCAACACCC ACGCCTACAC ACATTCCGTG GGCGAGGCTC 
0241 ATCACGTGTT CCTCAATCTG CACACGCTGC GATTCTACTG CCTGCCGGAT AATTACGAGA 
0301 TCATCGACTC CTCGTTGGAC GATATCAAAT ACGTGCTAAA TCCAACGTTC ACACGCCAGG 
0361 AGATCAGCAA GTTGGATCAG TTACAGCCGA AGCATTCGCG A-ACCGTGGA CGGTGTTCTG 
0421 TACTTACCCG GCGTCGTGGG TTTGAACAAC ATCAAAGCGA ACGACTACTG CAATGTGGTG 
0481 CTGCATGCAC TCTCCCACGT C 
 Assemble Data

7288R-1.IR_full       1   TGGAGAAGACGCCGGCAAATCCCGTCGAAGAGGATGAGACGCCCTCCGTGTTCAATCCGA 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7288R-1.in silico     1   TGGAGAAGACGCCGGCAAATCCCGTCGAAGAGGATGAGACGCCCTCCGTGTTCAATCCGA 60


7288R-1.IR_full       61  AGTACAGGGTGTGTCCCTACTTGGACACCATCAACCGTAACCTGCTGGATTTCGATTTCG 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7288R-1.in silico     61  AGTACAGGGTGTGTCCCTACTTGGACACCATCAACCGTAACCTGCTGGATTTCGATTTCG 120


7288R-1.IR_full       121 AGAAGCTTTGCTCCATTTCGCTGACGAGGATCAATGTTTATGCCTGCCTGGTGTGCGGCA 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7288R-1.in silico     121 AGAAGCTTTGCTCCATTTCGCTGACGAGGATCAATGTTTATGCCTGCCTGGTGTGCGGCA 180


7288R-1.IR_full       181 AGTACTTCCAGGGACGTGGCACCAACACCCACGCCTACACACATTCCGTGGGCGAGGCTC 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7288R-1.in silico     181 AGTACTTCCAGGGACGTGGCACCAACACCCACGCCTACACACATTCCGTGGGCGAGGCTC 240


7288R-1.IR_full       241 ATCACGTGTTCCTCAATCTGCACACGCTGCGATTCTACTGCCTGCCGGATAATTACGAGA 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7288R-1.in silico     241 ATCACGTGTTCCTCAATCTGCACACGCTGCGATTCTACTGCCTGCCGGATAATTACGAGA 300


7288R-1.IR_full       301 TCATCGACTCCTCGTTGGACGATATCAAATACGTGCTAAATCCAACGTTCACACGCCAGG 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7288R-1.in silico     301 TCATCGACTCCTCGTTGGACGATATCAAATACGTGCTAAATCCAACGTTCACACGCCAGG 360


7288R-1.IR_full       361 AGATCAGCAAGTTGGATCAGTTACAGCCGAAGCATTCGCGANACCGTGGACGGTGTTCTG 420
                          ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||
7288R-1.in silico     361 AGATCAGCAAGTTGGATCAGTTACAGCCGAAGCATTCGCGA-ACCGTGGACGGTGTTCTG 420


7288R-1.IR_full       421 TACTTACCCGGCGTCGTGGGTTTGAACAACATCAAAGCGAACGACTACTGCAATGTGGTG 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7288R-1.in silico     421 TACTTACCCGGCGTCGTGGGTTTGAACAACATCAAAGCGAACGACTACTGCAATGTGGTG 480


7288R-1.IR_full       481 CTGCATGCACTCTCCCACGTC 501
                          |||||||||||||||||||||
7288R-1.in silico     481 CTGCATGCACTCTCCCACGTC 501

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_133106.2  CG7288-RA (CG7288), mRNA 
0   NM_142457.2  CG7669-RA (CG7669), mRNA 
0   NM_134871.1  CG3131-RA (Duox), mRNA 
0   14  NM_133083.1  CG15040-RA (CG15040), mRNA 
0   NM_080527.2  CG10016-RB, transcript variant B (drm), mRNA 
0   NM_164545.1  CG10016-RA, transcript variant A (drm), mRNA 
0   NM_001014662.1  CG10693-RF, transcript variant F (slo), mRNA 
0   NM_001014664.1  CG10693-RD, transcript variant D (slo), mRNA 
0   NM_001014663.1  CG10693-RE, transcript variant E (slo), mRNA 
0   NM_001014653.1  CG10693-RO, transcript variant O (slo), mRNA 
0   NM_001014660.1  CG10693-RH, transcript variant H (slo), mRNA 
0   NM_001014658.1  CG10693-RJ, transcript variant J (slo), mRNA 
0   NM_001014659.1  CG10693-RI, transcript variant I (slo), mRNA 
0   NM_001014656.1  CG10693-RL, transcript variant L (slo), mRNA 
0   NM_001014657.1  CG10693-RK, transcript variant K (slo), mRNA 
0   NM_079762.2  CG10693-RA, transcript variant A (slo), mRNA 
0   NM_001014661.1  CG10693-RG, transcript variant G (slo), mRNA 
0   NM_001014655.1  CG10693-RM, transcript variant M (slo), mRNA 
0   NM_001014651.1  CG10693-RQ, transcript variant Q (slo), mRNA 
0   NM_001014652.1  CG10693-RP, transcript variant P (slo), mRNA 
0   NM_001014654.1  CG10693-RN, transcript variant N (slo), mRNA 
0   NM_170164.1  CG10693-RB, transcript variant B (slo), mRNA 
0   NM_206566.1  CG10693-RC, transcript variant C (slo), mRNA 
0   NM_142597.2  CG12254-RA (MED25), mRNA 
0   NM_133002.1  CG5800-RA (CG5800), mRNA 
0   20  NM_001032051.1  CG33715-RD, transcript variant D (Msp-300), mRNA 
0   19  NM_001032053.1  CG33715-RB, transcript variant B (Msp-300), mRNA 
0   NM_001038880.1  CG3204-RB, transcript variant B (Rap2l), mRNA 
0   NM_141553.1  CG9770-RA (CG9770), mRNA 
0   NM_142666.3  CG17274-RA, transcript variant A (CG17274), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.