National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  

Suspension of shipments during Golden Week Holidays: From 4 May to 11 May, deadline 21 April.

NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 7225R-1 
 Symbol wbl  Full Name windbeutel 
 CG No CG7225  Old CG No CG7225 
 Synonyms wind, Windb, wbt, Wind, CG7225, wbl 
 Accession No (Link to NCBI) NM_166339.1 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
[Please submit your publication]
Ito S, Ueda T, Ueno A, Nakagawa H, Taniguchi H, Kayukawa N, Miki T.
A genetic screen in Drosophila for regulators of human prostate cancer progression.
Biochem Biophys Res Commun (2014) 451(4) 548-55 [ PubMed ID = 25117438 ] [ RRC reference ]

Cho Y, Lai CM, Lin KY, Hsu HJ.
A Targeted RNAi Screen Reveals Drosophila Female-Sterile Genes That Control the Size of Germline Stem Cell Niche During Development.
G3 (Bethesda) (2018) 8(7) 2345-2354 [ PubMed ID = 29764959 ] [ RRC reference ]  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                          || | |||||||||||||||||||||||||||||||| |||||||||||||||||||||| silico     1   CTGGATGAGCTGAGTTTCGAGAAGACGGTGGAACGAT-TTCCCTACTCCGTAGTGAAATT 60

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     61  TGATATCGCATATCCGTATGGGGAAAAGCATGAGGCCTTTACCGCCTTCTCCAAATCTGC 120

                          ||||||||||||||||||||||||||| |||||||||||||||| ||||||||||||| | silico     121 CCACAAGGCAACTAAAGATCTGCTAAT-AGCCACCGTGGGTGTC-AAGGACTATGGAG-A 180

                          ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| silico     181 ACTGGAGAACA-AGGCCCTGGGCGACCGTTACAAAGTCGACGACAAGAACTTCCCGAGTA 240

                          |||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| silico     241 TCTTCCTGTTCAAGGGCAACGCTGATGAGTACGTCCAGCTTCCTAGCCACGTCGACGTAA 300

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     301 CGCTGGACAATCTGAAGGCTTTTGTCAGTGCCAACACACCTCTGTACATCGGTCGTGATG 360

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     361 GCTGCATCAAAGAGTTCAACGAAGTGCTCAAGAACTATGCCAATATCCCCGATGCAGAGC 420

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     421 AACTGAAGCTTATCGAAAAGCTGCAGGCCAAGCAGGAGCAGCTGACCGATCCCGAGCAGC 480

                          ||||||||||||||||||||||||| silico     481 AGCAGAACGCCAGGGCCTATCTGAT 505

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_166339.1  CG7225-RA (wbl), mRNA 
0   NM_168064.2  CG14998-RA, transcript variant A (CG14998), mRNA 
0   NM_168063.2  CG14998-RD, transcript variant D (CG14998), mRNA 
0   NM_168062.2  CG14998-RE, transcript variant E (CG14998), mRNA 
0   NM_168061.2  CG14998-RB, transcript variant B (CG14998), mRNA 
0   NM_139604.2  CG14998-RC, transcript variant C (CG14998), mRNA 
0   NM_166929.1  CG3835-RB, transcript variant B (CG3835), mRNA 
0   NM_166930.1  CG3835-RC, transcript variant C (CG3835), mRNA 
0   NM_130626.2  CG3835-RA, transcript variant A (CG3835), mRNA 
0   NM_169141.1  CG1021-RA, transcript variant A (CG1021), mRNA 
0   NM_141397.2  CG1021-RB, transcript variant B (CG1021), mRNA 
0   NM_078993.2  CG8604-RA (Amph), mRNA 
0   13  17  NM_132457.1  CG11122-RA (CG11122), mRNA 
0   NM_137712.3  CG30389-RC, transcript variant C (CG30389), mRNA 
0   NM_137711.3  CG30389-RA, transcript variant A (CG30389), mRNA 
0   NM_166428.2  CG30389-RB, transcript variant B (CG30389), mRNA 
0   NM_132956.1  CG9086-RA (CG9086), mRNA 
0   11  NM_078523.2  CG2252-RB, transcript variant B (fs(1)h), mRNA 
0   NM_167144.2  CG2252-RA, transcript variant A (fs(1)h), mRNA 
0   NM_206647.1  CG2252-RC, transcript variant C (fs(1)h), mRNA 
0   NM_206646.1  CG2252-RD, transcript variant D (fs(1)h), mRNA 
0   NM_206645.1  CG2252-RE, transcript variant E (fs(1)h), mRNA 
0   NM_137695.2  CG10540-RA (cpa), mRNA 
0   NM_141948.1  CG5333-RA (trus), mRNA 
0   10  NM_138220.1  CG13889-RA (CG13889), mRNA 
0   NM_135101.1  CG18266-RA (CG18266), mRNA 
0   NM_132636.2  CG12723-RA (CG12723), mRNA 
0   NM_166250.1  CG30111-RA (CG30111), mRNA 
0   NM_141529.2  CG11694-RA (CG11694), mRNA 
0   NM_143344.2  CG5520-RA (Gp93), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.