National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 7225R-1 
 Symbol wbl  Full Name windbeutel 
 CG No CG7225  Old CG No CG7225 
 Synonyms wind, Windb, wbt, Wind, CG7225, wbl 
 Accession No (Link to NCBI) NM_166339.1 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
Ito S, Ueda T, Ueno A, Nakagawa H, Taniguchi H, Kayukawa N, Miki T.
A genetic screen in Drosophila for regulators of human prostate cancer progression.
Biochem. Biophys. Res. Commun. (2014) 451(4) 548-55 [ PubMed ID = 25117438 ] [ RRC reference ]

Cho Y, Lai CM, Lin KY, Hsu HJ.
A Targeted RNAi Screen Reveals Drosophila Female-Sterile Genes That Control the Size of Germline Stem Cell Niche During Development.
G3 (Bethesda) (2018) 8(7) 2345-2354 [ PubMed ID = 29764959 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgCTGGATGAGCTGAGTTTCGAG 
 Primer Seq. 3'
aatctagaggtaccATCAGATAGGCCCTGGCGTTC 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 CTNGNTGAGC TGAGTTTCGA GAAGACGGTG GAACGATCTT CCCTACTCCG TAGTGAAATT 
0061 TGATATCGCA TATCCGTATG GGGAAAAGCA TGAGGCCTTT ACCGCCTTCT CCAAATCTGC 
0121 CCACAAGGCA ACTAAAGATC TGCTAATNAG CCACCGTGGG TGTCNAAGGA CTATGGAGTA 
0181 ACTGGAGAAC ANAGGCCCTG GGCGACCGTT ACAAAGTCGA CGACAAGAAC TTCCCGAGTA 
0241 TCTTCCTGTT CAAGGGCAAC GCTGATGAGT ACGTCCAGCT TCCTAGNCAC GTCGACGTAA 
0301 CGCTGGACAA TCTGAAGGCT TTTGTCAGTG CCAACACACC TCTGTACATC GGTCGTGATG 
0361 GCTGCATCAA AGAGTTCAAC GAAGTGCTCA AGAACTATGC CAATATCCCC GATGCAGAGC 
0421 AACTGAAGCT TATCGAAAAG CTGCAGGCCA AGCAGGAGCA GCTGACCGAT CCCGAGCAGC 
0481 AGCAGAACgC CAGGGCCTAT CTGAT 
 in silico PCR Fragment
0001 CTGGATGAGC TGAGTTTCGA GAAGACGGTG GAACGAT-TT CCCTACTCCG TAGTGAAATT 
0061 TGATATCGCA TATCCGTATG GGGAAAAGCA TGAGGCCTTT ACCGCCTTCT CCAAATCTGC 
0121 CCACAAGGCA ACTAAAGATC TGCTAAT-AG CCACCGTGGG TGTC-AAGGA CTATGGAG-A 
0181 ACTGGAGAAC A-AGGCCCTG GGCGACCGTT ACAAAGTCGA CGACAAGAAC TTCCCGAGTA 
0241 TCTTCCTGTT CAAGGGCAAC GCTGATGAGT ACGTCCAGCT TCCTAGCCAC GTCGACGTAA 
0301 CGCTGGACAA TCTGAAGGCT TTTGTCAGTG CCAACACACC TCTGTACATC GGTCGTGATG 
0361 GCTGCATCAA AGAGTTCAAC GAAGTGCTCA AGAACTATGC CAATATCCCC GATGCAGAGC 
0421 AACTGAAGCT TATCGAAAAG CTGCAGGCCA AGCAGGAGCA GCTGACCGAT CCCGAGCAGC 
0481 AGCAGAACGC CAGGGCCTAT CTGAT 
 Assemble Data

7225R-1.IR_full       1   CTNGNTGAGCTGAGTTTCGAGAAGACGGTGGAACGATCTTCCCTACTCCGTAGTGAAATT 60
                          || | |||||||||||||||||||||||||||||||| ||||||||||||||||||||||
7225R-1.in silico     1   CTGGATGAGCTGAGTTTCGAGAAGACGGTGGAACGAT-TTCCCTACTCCGTAGTGAAATT 60


7225R-1.IR_full       61  TGATATCGCATATCCGTATGGGGAAAAGCATGAGGCCTTTACCGCCTTCTCCAAATCTGC 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7225R-1.in silico     61  TGATATCGCATATCCGTATGGGGAAAAGCATGAGGCCTTTACCGCCTTCTCCAAATCTGC 120


7225R-1.IR_full       121 CCACAAGGCAACTAAAGATCTGCTAATNAGCCACCGTGGGTGTCNAAGGACTATGGAGTA 180
                          ||||||||||||||||||||||||||| |||||||||||||||| ||||||||||||| |
7225R-1.in silico     121 CCACAAGGCAACTAAAGATCTGCTAAT-AGCCACCGTGGGTGTC-AAGGACTATGGAG-A 180


7225R-1.IR_full       181 ACTGGAGAACANAGGCCCTGGGCGACCGTTACAAAGTCGACGACAAGAACTTCCCGAGTA 240
                          ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||
7225R-1.in silico     181 ACTGGAGAACA-AGGCCCTGGGCGACCGTTACAAAGTCGACGACAAGAACTTCCCGAGTA 240


7225R-1.IR_full       241 TCTTCCTGTTCAAGGGCAACGCTGATGAGTACGTCCAGCTTCCTAGNCACGTCGACGTAA 300
                          |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||
7225R-1.in silico     241 TCTTCCTGTTCAAGGGCAACGCTGATGAGTACGTCCAGCTTCCTAGCCACGTCGACGTAA 300


7225R-1.IR_full       301 CGCTGGACAATCTGAAGGCTTTTGTCAGTGCCAACACACCTCTGTACATCGGTCGTGATG 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7225R-1.in silico     301 CGCTGGACAATCTGAAGGCTTTTGTCAGTGCCAACACACCTCTGTACATCGGTCGTGATG 360


7225R-1.IR_full       361 GCTGCATCAAAGAGTTCAACGAAGTGCTCAAGAACTATGCCAATATCCCCGATGCAGAGC 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7225R-1.in silico     361 GCTGCATCAAAGAGTTCAACGAAGTGCTCAAGAACTATGCCAATATCCCCGATGCAGAGC 420


7225R-1.IR_full       421 AACTGAAGCTTATCGAAAAGCTGCAGGCCAAGCAGGAGCAGCTGACCGATCCCGAGCAGC 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7225R-1.in silico     421 AACTGAAGCTTATCGAAAAGCTGCAGGCCAAGCAGGAGCAGCTGACCGATCCCGAGCAGC 480


7225R-1.IR_full       481 AGCAGAACGCCAGGGCCTATCTGAT 505
                          |||||||||||||||||||||||||
7225R-1.in silico     481 AGCAGAACGCCAGGGCCTATCTGAT 505

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_166339.1  CG7225-RA (wbl), mRNA 
0   NM_168064.2  CG14998-RA, transcript variant A (CG14998), mRNA 
0   NM_168063.2  CG14998-RD, transcript variant D (CG14998), mRNA 
0   NM_168062.2  CG14998-RE, transcript variant E (CG14998), mRNA 
0   NM_168061.2  CG14998-RB, transcript variant B (CG14998), mRNA 
0   NM_139604.2  CG14998-RC, transcript variant C (CG14998), mRNA 
0   NM_166929.1  CG3835-RB, transcript variant B (CG3835), mRNA 
0   NM_166930.1  CG3835-RC, transcript variant C (CG3835), mRNA 
0   NM_130626.2  CG3835-RA, transcript variant A (CG3835), mRNA 
0   NM_169141.1  CG1021-RA, transcript variant A (CG1021), mRNA 
0   NM_141397.2  CG1021-RB, transcript variant B (CG1021), mRNA 
0   NM_078993.2  CG8604-RA (Amph), mRNA 
0   13  17  NM_132457.1  CG11122-RA (CG11122), mRNA 
0   NM_137712.3  CG30389-RC, transcript variant C (CG30389), mRNA 
0   NM_137711.3  CG30389-RA, transcript variant A (CG30389), mRNA 
0   NM_166428.2  CG30389-RB, transcript variant B (CG30389), mRNA 
0   NM_132956.1  CG9086-RA (CG9086), mRNA 
0   11  NM_078523.2  CG2252-RB, transcript variant B (fs(1)h), mRNA 
0   NM_167144.2  CG2252-RA, transcript variant A (fs(1)h), mRNA 
0   NM_206647.1  CG2252-RC, transcript variant C (fs(1)h), mRNA 
0   NM_206646.1  CG2252-RD, transcript variant D (fs(1)h), mRNA 
0   NM_206645.1  CG2252-RE, transcript variant E (fs(1)h), mRNA 
0   NM_137695.2  CG10540-RA (cpa), mRNA 
0   NM_141948.1  CG5333-RA (trus), mRNA 
0   10  NM_138220.1  CG13889-RA (CG13889), mRNA 
0   NM_135101.1  CG18266-RA (CG18266), mRNA 
0   NM_132636.2  CG12723-RA (CG12723), mRNA 
0   NM_166250.1  CG30111-RA (CG30111), mRNA 
0   NM_141529.2  CG11694-RA (CG11694), mRNA 
0   NM_143344.2  CG5520-RA (Gp93), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.