National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 7170R-3 
 Symbol Jon66Cii  Full Name Jonah 66Cii 
 CG No CG7170  Old CG No CG7170 
 Synonyms 66C, CG7170, SP165, Jon66C, Jon66Cii 
 Accession No (Link to NCBI) NM_139960.1 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
[Please submit your publication]
Kambris Z, Brun S, Jang IH, Nam HJ, Romeo Y, Takahashi K, Lee WJ, Ueda R, Lemaitre B.
Drosophila immunity: a large-scale in vivo RNAi screen identifies five serine proteases required for Toll activation.
Curr Biol (2006) 16(8) 808-13 [ PubMed ID = 16631589 ] [ RRC reference ]  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     1   CGGTCCACACCAAGGACATGCAGGGTCGCATCACCAACGGCTATCCGGCTGAGGAGGGCA 60

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     61  AGGCTCCCTACACCGTCGGTCTGGGCTTCAGCGGCGGCTGGTGGTGCGGTGGTTCGATCA 120

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     121 TCGCACACGATTGGGTGCTCACCGCCGAGCACTGCATCGGAGATGCTGACTCCGTAACTG 180

                          ||||||||||| |||||||||||| ||||||||||||||||||||||||||||||||||| silico     181 TCTACTTCGGA-GCCACCTGGCGC-ACCAACGCCCAGTTCACCCACTGGGTTGGCAACGG 240

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     241 TAACTTTATCAAGCACTCATCCGCCGATATTGCCCTCATCCGCATTCCCCACGTGGACTT 300

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     301 CTGGCACATGGTGAACAAGGTGGAGCTGCCCAGCTACAACGATCGCTACAACGACTACAA 360

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     361 CGAATGGTGGGCTGTTGCCTGCGGCTGGGGAGGCACCTATGACGGCAGCCCACTGCCCGA 420

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     421 CTACCTGCAGTGTGTCGATCTCCAGATCATCCACAACTCCGAGTGCTCCGGATACTATGG 480

7170R-3.IR_full       481 AAGCGTGGGAGACAACATCCTC 502
                          |||||||||||||||||||||| silico     481 AAGCGTGGGAGACAACATCCTC 502

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_139960.1  CG7170-RA (Jon66Cii), mRNA 
53.52   258  60  30  25  NM_168271.1  CG7118-RA (Jon66Ci), mRNA 
8.71   42  81  28  37  NM_001038784.1  CG8867-RB, transcript variant B (Jon25Bi), mRNA 
8.71   42  81  28  37  NM_078753.2  CG8867-RA, transcript variant A (Jon25Bi), mRNA 
8.09   39  87  102  101  NM_135037.1  CG8871-RA (Jon25Biii), mRNA 
2.48   12  34  59  69  NM_143543.2  CG18030-RA (Jon99Fi), mRNA 
1.65   42  34  74  NM_079830.2  CG31034-RA (Jon99Cii), mRNA 
1.65   42  33  66  NM_170451.2  CG31362-RA (Jon99Ciii), mRNA 
1.65   26  30  47  NM_165618.1  CG8579-RA (Jon44E), mRNA 
0.62   19  16  NM_139756.2  CG6483-RA (Jon65Aiii), mRNA 
0.62   18  16  23  NM_139757.1  CG6580-RA (Jon65Aii), mRNA 
0.2   37  58  66  NM_143542.1  CG2229-RA (Jon99Fii), mRNA 
0.2   14  29  NM_140084.1  CG18180-RA (CG18180), mRNA 
0   34  28  46  NM_135038.1  CG8869-RA (Jon25Bii), mRNA 
0   37  44  NM_139758.1  CG10475-RA (Jon65Ai), mRNA 
0   NM_140737.1  CG6298-RA (Jon74E), mRNA 
0   14  16  NM_079220.1  CG6457-RA (yip7), mRNA 
0   NM_139753.1  CG10477-RA (CG10477), mRNA 
0   NM_134673.2  CG11912-RA (CG11912), mRNA 
0   NM_140082.1  CG8329-RA (CG8329), mRNA 
0   NM_206266.1  CG12008-RB, transcript variant B (kst), mRNA 
0   NM_206265.1  CG12008-RC, transcript variant C (kst), mRNA 
0   NM_079176.1  CG12008-RA, transcript variant A (kst), mRNA 
0   NM_001014500.1  CG33558-RA (CG33558), mRNA 
0   NM_079755.1  CG6331-RA (Orct), mRNA 
0   NM_169369.1  CG6584-RE, transcript variant E (SelR), mRNA 
0   NM_169371.1  CG6584-RD, transcript variant D (SelR), mRNA 
0   NM_169368.1  CG6584-RC, transcript variant C (SelR), mRNA 
0   NM_169370.2  CG6584-RB, transcript variant B (SelR), mRNA 
0   NM_141773.2  CG6584-RA, transcript variant A (SelR), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.