National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 7170R-2 
 Symbol Jon66Cii  Full Name Jonah 66Cii 
 CG No CG7170  Old CG No CG7170 
 Synonyms 66C, CG7170, SP165, Jon66C, Jon66Cii 
 Accession No (Link to NCBI) NM_139960.1 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Kambris Z, Brun S, Jang IH, Nam HJ, Romeo Y, Takahashi K, Lee WJ, Ueda R, Lemaitre B.
Drosophila immunity: a large-scale in vivo RNAi screen identifies five serine proteases required for Toll activation.
Curr Biol (2006) 16(8) 808-13 [ PubMed ID = 16631589 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgCGGTCCACACCAAGGACATGC 
 Primer Seq. 3'
aatctagaggtaccGAGGATGTTGTCTCCCACGCT 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 CGGTCCACAC CAAGGACATG CAGGGTCGCA TCACCAACGG CTATCCGGCT GAGGAGGGCA 
0061 AGGCTCCCTA CACCGTCGGT CTGGGCTTCA GCGGCGGCTG GTGGTGCGGT GGTTCGATCA 
0121 TCGCACACGA TTGGGTGCTC ACCGCCGAGC ACTGCATCGG AGATGCTGAC TCCGTAACTG 
0181 TCTACTTCGG ANGCCACCTG GCGCNACCAA CGCCCAGTTC ACCCACTGGG TTGGCAACGG 
0241 TAACTTTATC AAGCACTCAT CCGCCGATAT TGCCCTCATC CGCATTCCCC ACGTGGACTT 
0301 CTGGCACATG GTGAACAAGG TGGAGCTGCC CAGCTACAAC GATCGCTACA ACGACTACAA 
0361 CGAATGGTGG GCTGTTgcCT GCGGCTGGGG AGGCACCTAT GACgGCAGCC CACTGCCCGA 
0421 CTACCTGCAG TGTGTCGATC TCCAGATCAT CCACAACTCC GAGTGCTCCG GATACTATGG 
0481 AAGCGTGGGA GACAACATCC TC 
 in silico PCR Fragment
0001 CGGTCCACAC CAAGGACATG CAGGGTCGCA TCACCAACGG CTATCCGGCT GAGGAGGGCA 
0061 AGGCTCCCTA CACCGTCGGT CTGGGCTTCA GCGGCGGCTG GTGGTGCGGT GGTTCGATCA 
0121 TCGCACACGA TTGGGTGCTC ACCGCCGAGC ACTGCATCGG AGATGCTGAC TCCGTAACTG 
0181 TCTACTTCGG A-GCCACCTG GCGC-ACCAA CGCCCAGTTC ACCCACTGGG TTGGCAACGG 
0241 TAACTTTATC AAGCACTCAT CCGCCGATAT TGCCCTCATC CGCATTCCCC ACGTGGACTT 
0301 CTGGCACATG GTGAACAAGG TGGAGCTGCC CAGCTACAAC GATCGCTACA ACGACTACAA 
0361 CGAATGGTGG GCTGTTGCCT GCGGCTGGGG AGGCACCTAT GACGGCAGCC CACTGCCCGA 
0421 CTACCTGCAG TGTGTCGATC TCCAGATCAT CCACAACTCC GAGTGCTCCG GATACTATGG 
0481 AAGCGTGGGA GACAACATCC TC 
 Assemble Data

7170R-2.IR_full       1   CGGTCCACACCAAGGACATGCAGGGTCGCATCACCAACGGCTATCCGGCTGAGGAGGGCA 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7170R-2.in silico     1   CGGTCCACACCAAGGACATGCAGGGTCGCATCACCAACGGCTATCCGGCTGAGGAGGGCA 60


7170R-2.IR_full       61  AGGCTCCCTACACCGTCGGTCTGGGCTTCAGCGGCGGCTGGTGGTGCGGTGGTTCGATCA 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7170R-2.in silico     61  AGGCTCCCTACACCGTCGGTCTGGGCTTCAGCGGCGGCTGGTGGTGCGGTGGTTCGATCA 120


7170R-2.IR_full       121 TCGCACACGATTGGGTGCTCACCGCCGAGCACTGCATCGGAGATGCTGACTCCGTAACTG 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7170R-2.in silico     121 TCGCACACGATTGGGTGCTCACCGCCGAGCACTGCATCGGAGATGCTGACTCCGTAACTG 180


7170R-2.IR_full       181 TCTACTTCGGANGCCACCTGGCGCNACCAACGCCCAGTTCACCCACTGGGTTGGCAACGG 240
                          ||||||||||| |||||||||||| |||||||||||||||||||||||||||||||||||
7170R-2.in silico     181 TCTACTTCGGA-GCCACCTGGCGC-ACCAACGCCCAGTTCACCCACTGGGTTGGCAACGG 240


7170R-2.IR_full       241 TAACTTTATCAAGCACTCATCCGCCGATATTGCCCTCATCCGCATTCCCCACGTGGACTT 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7170R-2.in silico     241 TAACTTTATCAAGCACTCATCCGCCGATATTGCCCTCATCCGCATTCCCCACGTGGACTT 300


7170R-2.IR_full       301 CTGGCACATGGTGAACAAGGTGGAGCTGCCCAGCTACAACGATCGCTACAACGACTACAA 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7170R-2.in silico     301 CTGGCACATGGTGAACAAGGTGGAGCTGCCCAGCTACAACGATCGCTACAACGACTACAA 360


7170R-2.IR_full       361 CGAATGGTGGGCTGTTGCCTGCGGCTGGGGAGGCACCTATGACGGCAGCCCACTGCCCGA 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7170R-2.in silico     361 CGAATGGTGGGCTGTTGCCTGCGGCTGGGGAGGCACCTATGACGGCAGCCCACTGCCCGA 420


7170R-2.IR_full       421 CTACCTGCAGTGTGTCGATCTCCAGATCATCCACAACTCCGAGTGCTCCGGATACTATGG 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7170R-2.in silico     421 CTACCTGCAGTGTGTCGATCTCCAGATCATCCACAACTCCGAGTGCTCCGGATACTATGG 480


7170R-2.IR_full       481 AAGCGTGGGAGACAACATCCTC 502
                          ||||||||||||||||||||||
7170R-2.in silico     481 AAGCGTGGGAGACAACATCCTC 502

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_139960.1  CG7170-RA (Jon66Cii), mRNA 
53.52   258  60  30  25  NM_168271.1  CG7118-RA (Jon66Ci), mRNA 
8.71   42  81  28  37  NM_001038784.1  CG8867-RB, transcript variant B (Jon25Bi), mRNA 
8.71   42  81  28  37  NM_078753.2  CG8867-RA, transcript variant A (Jon25Bi), mRNA 
8.09   39  87  102  101  NM_135037.1  CG8871-RA (Jon25Biii), mRNA 
2.48   12  34  59  69  NM_143543.2  CG18030-RA (Jon99Fi), mRNA 
1.65   42  34  74  NM_079830.2  CG31034-RA (Jon99Cii), mRNA 
1.65   42  33  66  NM_170451.2  CG31362-RA (Jon99Ciii), mRNA 
1.65   26  30  47  NM_165618.1  CG8579-RA (Jon44E), mRNA 
0.62   19  16  NM_139756.2  CG6483-RA (Jon65Aiii), mRNA 
0.62   18  16  23  NM_139757.1  CG6580-RA (Jon65Aii), mRNA 
0.2   37  58  66  NM_143542.1  CG2229-RA (Jon99Fii), mRNA 
0.2   14  29  NM_140084.1  CG18180-RA (CG18180), mRNA 
0   34  28  46  NM_135038.1  CG8869-RA (Jon25Bii), mRNA 
0   37  44  NM_139758.1  CG10475-RA (Jon65Ai), mRNA 
0   NM_140737.1  CG6298-RA (Jon74E), mRNA 
0   14  16  NM_079220.1  CG6457-RA (yip7), mRNA 
0   NM_139753.1  CG10477-RA (CG10477), mRNA 
0   NM_134673.2  CG11912-RA (CG11912), mRNA 
0   NM_140082.1  CG8329-RA (CG8329), mRNA 
0   NM_206266.1  CG12008-RB, transcript variant B (kst), mRNA 
0   NM_206265.1  CG12008-RC, transcript variant C (kst), mRNA 
0   NM_079176.1  CG12008-RA, transcript variant A (kst), mRNA 
0   NM_001014500.1  CG33558-RA (CG33558), mRNA 
0   NM_079755.1  CG6331-RA (Orct), mRNA 
0   NM_169369.1  CG6584-RE, transcript variant E (SelR), mRNA 
0   NM_169371.1  CG6584-RD, transcript variant D (SelR), mRNA 
0   NM_169368.1  CG6584-RC, transcript variant C (SelR), mRNA 
0   NM_169370.2  CG6584-RB, transcript variant B (SelR), mRNA 
0   NM_141773.2  CG6584-RA, transcript variant A (SelR), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.