National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 7103R-1 
 Symbol Pvf1  Full Name PDGF- and VEGF-related factor 1 
 CG No CG7103  Old CG No CG7103 
 Synonyms vegf1, PVF, PVF1, CG7103, PVFs, pvf1, Vegf17e-b, VEGF2-B, Vegf17e-a, Vegf17E, VEGF, DmVEGF-1, unnamed, l(1)G0146, EP1624, Pvf1 
 Accession No (Link to NCBI) NM_078683.2 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Tiwari P, Kumar A, Das RN, Malhotra V, VijayRaghavan K.
A Tendon Cell Specific RNAi Screen Reveals Novel Candidates Essential for Muscle Tendon Interaction.
PLoS ONE (2015) 10(10) e0140976 [ PubMed ID = 26488612 ] [ RRC reference ]

Garlena RA, Lennox AL, Baker LR, Parsons TE, Weinberg SM, Stronach BE.
The receptor tyrosine kinase Pvr promotes tissue closure by coordinating corpse removal and epidermal zippering.
Development (2015) 142(19) 3403-15 [ PubMed ID = 26293306 ] [ RRC reference ]

Álvarez-Fernández C, Tamirisa S, Prada F, Chernomoretz A, Podhajcer O, Blanco E, Martín-Blanco E.
Identification and functional analysis of healing regulators in Drosophila.
PLoS Genet. (2015) 11(2) e1004965 [ PubMed ID = 25647511 ] [ RRC reference ]  
 Comment Lost by accident. Kindly donated by Dr. Stronach. 
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgCCATTGCTCATCCTGCCAGTG 
 Primer Seq. 3'
aatctagaggtaccGTGGATCCGCAGCATCCATTG 
 Predicted Fragment Size
497 
 IR fragment full Seq
0001 CCATTGCTCA TCCTGCCAGT GCTCCTTCTC GTCCTGATCG TCAGCGAGGC AGCGGCGGGC 
0061 TCCTTGGTGT CCCCGAACAA CAGGCAACCA TCGCAGAGGT TCTTCTACGC CGCCGCCACG 
0121 TCCTCCTCCT CCACGCAGAC CAAGGTGCGC CTGCTCCGCC AGgcGGACGA TCCCAGTGCG 
0181 GCGCCGGGTG CACTGGAGGG CAGCTGCTGC CAAGGAGCAG CTGCGGAAGC CGGAACACCA 
0241 TTGACGCTCC CACTGTCCGT GTCCGCTGAG CTGACCAACG TGACCGCCGA CTACGATGTG 
0301 TCCGGCGAGA TGCCCTCCTC CAAGGAAAAC TTTAAGCGCA GCATCATGAA ATCAACGGTG 
0361 AGGAATGCAA CGCCGGCGAG CTGCTCCCCG CAACCGACGA TCGTGGAGCT GAAGCCACCG 
0421 GCGGAGGACG AGGCGAACTA CTACTATATG CCCGCGTGCA CGCGGATCAG CCGATGCAAT 
0481 GGATGCTGCG GATCCAC 
 in silico PCR Fragment
0001 CCATTGCTCA TCCTGCCAGT GCTCCTTCTC GTCCTGATCG TCAGCGAGGC AGCGGCGGGC 
0061 TCCTTGGTGT CCCCGAACAA CAGGCAACCA TCGCAGAGGT TCTTCTACGC CGCCGCCACG 
0121 TCCTCCTCCT CCACGCAGAC CAAGGTGCGC CTGCTCCGCC AGGCGGACGA TCCCAGTGCG 
0181 GCGCCGGGTG CACTGGAGGG CAGCTGCTGC CAAGGAGCAG CTGCGGAAGC CGGAACACCA 
0241 TTGACGCTCC CACTGTCCGT GTCCGCTGAG CTGACCAACG TGACCGCCGA CTACGATGTG 
0301 TCCGGCGAGA TGCCCTCCTC CAAGGAAAAC TTTAAGCGCA GCATCATGAA ATCAACCGTG 
0361 AGGAATGCAA CGCCGGCGAG CTGCTCCCCG CAACCGACGA TCGTGGAGCT GAAGCCACCG 
0421 GCGGAGGACG AGGCGAACTA CTACTATATG CCCGCGTGCA CGCGGATCAG CCGATGCAAT 
0481 GGATGCTGCG GATCCAC 
 Assemble Data

7103R-1.IR_full       1   CCATTGCTCATCCTGCCAGTGCTCCTTCTCGTCCTGATCGTCAGCGAGGCAGCGGCGGGC 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7103R-1.in silico     1   CCATTGCTCATCCTGCCAGTGCTCCTTCTCGTCCTGATCGTCAGCGAGGCAGCGGCGGGC 60


7103R-1.IR_full       61  TCCTTGGTGTCCCCGAACAACAGGCAACCATCGCAGAGGTTCTTCTACGCCGCCGCCACG 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7103R-1.in silico     61  TCCTTGGTGTCCCCGAACAACAGGCAACCATCGCAGAGGTTCTTCTACGCCGCCGCCACG 120


7103R-1.IR_full       121 TCCTCCTCCTCCACGCAGACCAAGGTGCGCCTGCTCCGCCAGGCGGACGATCCCAGTGCG 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7103R-1.in silico     121 TCCTCCTCCTCCACGCAGACCAAGGTGCGCCTGCTCCGCCAGGCGGACGATCCCAGTGCG 180


7103R-1.IR_full       181 GCGCCGGGTGCACTGGAGGGCAGCTGCTGCCAAGGAGCAGCTGCGGAAGCCGGAACACCA 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7103R-1.in silico     181 GCGCCGGGTGCACTGGAGGGCAGCTGCTGCCAAGGAGCAGCTGCGGAAGCCGGAACACCA 240


7103R-1.IR_full       241 TTGACGCTCCCACTGTCCGTGTCCGCTGAGCTGACCAACGTGACCGCCGACTACGATGTG 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7103R-1.in silico     241 TTGACGCTCCCACTGTCCGTGTCCGCTGAGCTGACCAACGTGACCGCCGACTACGATGTG 300


7103R-1.IR_full       301 TCCGGCGAGATGCCCTCCTCCAAGGAAAACTTTAAGCGCAGCATCATGAAATCAACGGTG 360
                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||
7103R-1.in silico     301 TCCGGCGAGATGCCCTCCTCCAAGGAAAACTTTAAGCGCAGCATCATGAAATCAACCGTG 360


7103R-1.IR_full       361 AGGAATGCAACGCCGGCGAGCTGCTCCCCGCAACCGACGATCGTGGAGCTGAAGCCACCG 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7103R-1.in silico     361 AGGAATGCAACGCCGGCGAGCTGCTCCCCGCAACCGACGATCGTGGAGCTGAAGCCACCG 420


7103R-1.IR_full       421 GCGGAGGACGAGGCGAACTACTACTATATGCCCGCGTGCACGCGGATCAGCCGATGCAAT 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7103R-1.in silico     421 GCGGAGGACGAGGCGAACTACTACTATATGCCCGCGTGCACGCGGATCAGCCGATGCAAT 480


7103R-1.IR_full       481 GGATGCTGCGGATCCAC 497
                          |||||||||||||||||
7103R-1.in silico     481 GGATGCTGCGGATCCAC 497

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   479  NM_078683.2  CG7103-RA (Pvf1), mRNA 
0.2   NM_137980.2  CG12491-RA (CG12491), mRNA 
0.2   NM_001043102.1  CG34105-RA (CG34105), mRNA 
0.2   10  14  NM_079093.2  CG9888-RA (Fib), mRNA 
0   NM_135302.3  CG7191-RA (CG7191), mRNA 
0   NM_133125.2  CG7537-RB (inx5), mRNA 
0   NM_141038.2  CG9389-RA (CG9389), mRNA 
0   10  NM_141334.1  CG10979-RA (CG10979), mRNA 
0   NM_143044.2  CG7016-RA (CG7016), mRNA 
0   14  NM_169121.1  CG10279-RF, transcript variant F (Rm62), mRNA 
0   14  NM_169122.1  CG10279-RB, transcript variant B (Rm62), mRNA 
0   14  NM_079519.2  CG10279-RA, transcript variant A (Rm62), mRNA 
0   14  NM_169120.1  CG10279-RC, transcript variant C (Rm62), mRNA 
0   14  NM_169118.1  CG10279-RD, transcript variant D (Rm62), mRNA 
0   14  NM_169119.1  CG10279-RE, transcript variant E (Rm62), mRNA 
0   NM_130717.3  CG32782-RC, transcript variant C (tlk), mRNA 
0   NM_206620.4  CG32782-RD, transcript variant D (tlk), mRNA 
0   NM_079163.2  CG1960-RA, transcript variant A (mu2), mRNA 
0   NM_167927.1  CG1960-RB, transcript variant B (mu2), mRNA 
0   NM_132404.1  CG2889-RA (CG2889), mRNA 
0   NM_206789.1  CG33253-RA (CG33253), mRNA 
0   NM_131982.1  CG3323-RA (CG3323), mRNA 
0   16  NM_169489.1  CG7518-RA, transcript variant A (CG7518), mRNA 
0   16  NM_141993.2  CG7518-RB, transcript variant B (CG7518), mRNA 
0   NM_137909.2  CG9882-RA (Art7), mRNA 
0   10  13  NM_141666.2  CG9492-RA (CG9492), mRNA 
0   30  NM_057695.3  CG4038-RA (CG4038), mRNA 
0   NM_169654.2  CG31302-RC, transcript variant C (CG31302), mRNA 
0   NM_169652.2  CG31302-RA, transcript variant A (CG31302), mRNA 
0   NM_169653.2  CG31302-RB, transcript variant B (CG31302), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.