National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  

Suspension of shipments during Golden Week Holidays: From 4 May to 11 May, deadline 21 April.

NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 7100R-3 
 Symbol CadN  Full Name Cadherin-N 
 CG No CG7100  Old CG No CG7100 
 Synonyms Ncad, N-cad, N-Cad, S(DmcycE[JP])2.12, ncad, CT21941, DN-Cad, DN-cad, DN, l(2)36Da, B, D-cad, l(2)Bld, NCad, anon-EST:CL32, CG7100, CadN, cad1, cadN 
 Accession No (Link to NCBI) NM_165229.1 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees semi-lethal 
 Map Viewer
[Please submit your publication]
Ito S, Ueda T, Ueno A, Nakagawa H, Taniguchi H, Kayukawa N, Miki T.
A genetic screen in Drosophila for regulators of human prostate cancer progression.
Biochem Biophys Res Commun (2014) 451(4) 548-55 [ PubMed ID = 25117438 ] [ RRC reference ]

Saj A, Arziman Z, Stempfle D, van Belle W, Sauder U, Horn T, D├╝rrenberger M, Paro R, Boutros M, Merdes G.
A combined ex vivo and in vivo RNAi screen for notch regulators in Drosophila reveals an extensive notch interaction network.
Dev Cell (2010) 18(5) 862-76 [ PubMed ID = 20493818 ] [ RRC reference ]

Umemori M, Habara O, Iwata T, Maeda K, Nishinoue K, Okabe A, Takemura M, Takahashi K, Saigo K, Ueda R, Adachi-Yamada T.
RNAi-mediated knockdown showing impaired cell survival in Drosophila wing imaginal disc.
Gene Regul Syst Bio (2009) 3 11-20 [ PubMed ID = 19838331 ] [ RRC reference ]  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     1   GAATCAGCTCAGGCAACGTTATATAACCAACCGATTTAATATATGCACCTGCGCGATATT 60

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     61  CTTGATATCCCTTCCATTTATTTTGGCCATAGAGGAGACCACATTTGCTGGTCTTTCGGC 120

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     121 GGAAAATGCGGCTCGCATGCTGGCCGGCAGTCCCGGGGATGTGGAAAAGTCCTCGTTGTC 180

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     181 GCATCACAGTGAAATGTCCTTGGTCCTGCCACACGATACCTATCCTGGATTCAGTATCAA 240

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     241 AAAGTTCAAAACCCATCCTGTAAAGATAAACGGTAGCTCCCACTCTGGTGCAGCTGCCTA 300

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     301 TCACATGTTGGACACGGACTACTCCAAGTACTTCACCGTACTGGAAGATGGTGTGGTGAT 360

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     361 GACCACGGCGGATATTTCCCCGCTTGTCAATCGTCCGGTTCAGTTGGTGGTTGTTGAACA 420

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     421 AACGCCCAATGCCACCAATACCCACAATCTGCAGCTGTTTGTGATGCACCGCAATGATAT 480

7100R-3.IR_full       481 GCTGCGATTTTCTGGATCCC 500
                          |||||||||||||||||||| silico     481 GCTGCGATTTTCTGGATCCC 500

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_001032106.1  CG7100-RL, transcript variant L (CadN), mRNA 
100   482  NM_001032107.1  CG7100-RK, transcript variant K (CadN), mRNA 
100   482  NM_001032109.1  CG7100-RI, transcript variant I (CadN), mRNA 
100   482  NM_001032108.1  CG7100-RJ, transcript variant J (CadN), mRNA 
100   482  NM_165231.1  CG7100-RE, transcript variant E (CadN), mRNA 
100   482  NM_165230.1  CG7100-RG, transcript variant G (CadN), mRNA 
100   482  NM_165229.1  CG7100-RA, transcript variant A (CadN), mRNA 
100   482  NM_165228.1  CG7100-RC, transcript variant C (CadN), mRNA 
100   482  NM_165227.1  CG7100-RD, transcript variant D (CadN), mRNA 
100   482  NM_165226.1  CG7100-RF, transcript variant F (CadN), mRNA 
100   482  NM_165225.1  CG7100-RB, transcript variant B (CadN), mRNA 
100   482  NM_165224.1  CG7100-RH, transcript variant H (CadN), mRNA 
0   NM_001043212.1  CG12591-RB, transcript variant B (dpr16), mRNA 
0   NM_141257.1  CG12591-RA, transcript variant A (dpr16), mRNA 
0   NM_136801.1  CG13228-RA (CG13228), mRNA 
0   NM_139371.1  CG13917-RA (CG13917), mRNA 
0   NM_131938.1  CG3568-RA (CG3568), mRNA 
0   NM_058145.3  CG2707-RA (fs(1)Ya), mRNA 
0   NM_134711.1  CG15824-RA (CG15824), mRNA 
0   NM_079609.2  CG6019-RA (mus308), mRNA 
0   NM_142031.2  CG17045-RA (yellow-e3), mRNA 
0   NM_132050.1  CG3011-RA (CG3011), mRNA 
0   NM_140298.2  CG6906-RA (CAH2), mRNA 
0   NM_141495.2  CG2791-RA (CG2791), mRNA 
0   NM_001042855.1  CG40305-RA (FucTC), mRNA 
0   NM_134494.2  CG12235-RA (Arp11), mRNA 
0   NM_079818.2  CG10002-RA (fkh), mRNA 
0   NM_079766.2  CG7005-RA (Esp), mRNA 
0   NM_168361.1  CG16711-RB, transcript variant B (CG16711), mRNA 
0   NM_140090.1  CG16711-RA, transcript variant A (CG16711), mRNA 
 Wing Disc
JNK signal
Caspase-3 signal
Dcompartment   Penetrance

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.