National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 7020R-2 
 Symbol DIP2  Full Name DISCO Interacting Protein 2 
 CG No CG7020  Old CG No CG7020 
 Synonyms CG7020, Ddip2, unnamed, DIP2 
 Accession No (Link to NCBI) NM_138175.2 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Nitta Y, Sugie A.
DISCO interacting protein 2 determines direction of axon projection under the regulation of c-Jun N-terminal kinase in the Drosophila mushroom body.
Biochem Biophys Res Commun (2017) 487(1) 116-121 [ PubMed ID = 28396149 ] [ RRC reference ]

Nitta Y, Yamazaki D, Sugie A, Hiroi M, Tabata T.
DISCO Interacting Protein 2 regulates axonal bifurcation and guidance of Drosophila mushroom body neurons.
Dev Biol (2017) 421(2) 233-244 [ PubMed ID = 27908785 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgCCTAAAGAAGCCAGAAGGCGA 
 Primer Seq. 3'
aatctagaggtaccATGGCATTGGAAGGCTGGGTT 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 CCTAAAGAAG CCAGAAgGNN NTAAAGTGAA AAGTACGCCG CCACCGCCAT ACTACAACGT 
0061 TAAAAATGCC AACAACAGCA CCAACCACGG AAACATCAAT AACGACGGCG TCATTGTGTC 
0121 CAGCGAGGGC TACAGTTATG TGACTGAAGT GCCCTCCCTG TCCTCCTCGC AGCAAAGACA 
0181 TTCCAAAAAA ATTGACTTCC ATCAGCAAGC CGCCATGAGC TTGTCATCGG CACCACAGAG 
0241 CGGAAATGCT GGGGCTCCTG GCTACGAAAA TATGCGACCG CAGGGTGGAG CAGTCGGCGA 
0301 TCCCGGGTAT CAGAACACTC GCGAACCAAG TGCTTTTCAG AACCAACAGT CAACTAATAA 
0361 TAGTCAGCAT CGTCAACGAC GCACACAGCG CAAAGTAACG CACAATGAGA AACGTTATCA 
0421 TTCTGAAGTA CGACAAGAGG CTGTGCAACA GGCCCTTGCA GCTCTTAAGG GACGGCCAAA 
0481 ACCCAGCCTT CCAATGCCAT  
 in silico PCR Fragment
0001 CCTAAAGAAG CCAGAAGGCG ATAAAGTGAA AAGTACGCCG CCACCGCCAT ACTACAACGT 
0061 TAAAAATGCC AACAACAGCA CCAACCACGG AAACATCAAT AACGACGGCG TCATTGTGTC 
0121 CAGCGAGGGC TACAGTTATG TGACTGAAGT GCCCTCCCTG TCCTCCTCGC AGCAAAGACA 
0181 TTCCAAAAAA ATTGACTTCC ATCAGCAAGC CGCCATGAGC TTGTCATCGG CACCACAGAG 
0241 CGGAAATGCT GGGGCTCCTG GCTACGAAAA TATGCGACCG CAGGGTGGAG CAGTCGGCGA 
0301 TCCCGGGTAT CAGAACACTC GCGAACCAAG TGCTTTTCAG AACCAACAGT CAACTAATAA 
0361 TAGTCAGCAT CGTCAACGAC GCACACAGCG CAAAGTAACG CACAATGAGA AACGTTATCA 
0421 TTCTGAAGTA CGACAAGAGG CTGTGCAACA GGCCCTTGCA GCTCTTAAGG GACGGCCAAA 
0481 ACCCAGCCTT CCAATGCCAT  
 Assemble Data

7020R-2.IR_full       1   CCTAAAGAAGCCAGAAGGNNNTAAAGTGAAAAGTACGCCGCCACCGCCATACTACAACGT 60
                          ||||||||||||||||||   |||||||||||||||||||||||||||||||||||||||
7020R-2.in silico     1   CCTAAAGAAGCCAGAAGGCGATAAAGTGAAAAGTACGCCGCCACCGCCATACTACAACGT 60


7020R-2.IR_full       61  TAAAAATGCCAACAACAGCACCAACCACGGAAACATCAATAACGACGGCGTCATTGTGTC 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7020R-2.in silico     61  TAAAAATGCCAACAACAGCACCAACCACGGAAACATCAATAACGACGGCGTCATTGTGTC 120


7020R-2.IR_full       121 CAGCGAGGGCTACAGTTATGTGACTGAAGTGCCCTCCCTGTCCTCCTCGCAGCAAAGACA 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7020R-2.in silico     121 CAGCGAGGGCTACAGTTATGTGACTGAAGTGCCCTCCCTGTCCTCCTCGCAGCAAAGACA 180


7020R-2.IR_full       181 TTCCAAAAAAATTGACTTCCATCAGCAAGCCGCCATGAGCTTGTCATCGGCACCACAGAG 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7020R-2.in silico     181 TTCCAAAAAAATTGACTTCCATCAGCAAGCCGCCATGAGCTTGTCATCGGCACCACAGAG 240


7020R-2.IR_full       241 CGGAAATGCTGGGGCTCCTGGCTACGAAAATATGCGACCGCAGGGTGGAGCAGTCGGCGA 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7020R-2.in silico     241 CGGAAATGCTGGGGCTCCTGGCTACGAAAATATGCGACCGCAGGGTGGAGCAGTCGGCGA 300


7020R-2.IR_full       301 TCCCGGGTATCAGAACACTCGCGAACCAAGTGCTTTTCAGAACCAACAGTCAACTAATAA 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7020R-2.in silico     301 TCCCGGGTATCAGAACACTCGCGAACCAAGTGCTTTTCAGAACCAACAGTCAACTAATAA 360


7020R-2.IR_full       361 TAGTCAGCATCGTCAACGACGCACACAGCGCAAAGTAACGCACAATGAGAAACGTTATCA 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7020R-2.in silico     361 TAGTCAGCATCGTCAACGACGCACACAGCGCAAAGTAACGCACAATGAGAAACGTTATCA 420


7020R-2.IR_full       421 TTCTGAAGTACGACAAGAGGCTGTGCAACAGGCCCTTGCAGCTCTTAAGGGACGGCCAAA 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7020R-2.in silico     421 TTCTGAAGTACGACAAGAGGCTGTGCAACAGGCCCTTGCAGCTCTTAAGGGACGGCCAAA 480


7020R-2.IR_full       481 ACCCAGCCTTCCAATGCCAT 500
                          ||||||||||||||||||||
7020R-2.in silico     481 ACCCAGCCTTCCAATGCCAT 500

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_138175.2  CG7020-RA (DIP2), mRNA 
0   NM_130646.2  CG14045-RA (CG14045), mRNA 
0   NM_140156.1  CG6418-RB (CG6418), mRNA 
0   NM_141072.2  CG7177-RA (CG7177), mRNA 
0   NM_079871.2  CG1775-RA, transcript variant A (Med), mRNA 
0   NM_170559.1  CG1775-RB, transcript variant B (Med), mRNA 
0   NM_141653.2  CG16789-RA (CG16789), mRNA 
0   17  NM_078717.2  CG3696-RA, transcript variant A (kis), mRNA 
0   14  NM_165046.1  CG9239-RB, transcript variant B (B4), mRNA 
0   14  NM_057977.3  CG9239-RA, transcript variant A (B4), mRNA 
0   NM_137729.1  CG9752-RA (CG9752), mRNA 
0   13  NM_169136.1  CG10295-RA, transcript variant A (Pak), mRNA 
0   NM_165089.2  CG3479-RA, transcript variant A (osp), mRNA 
0   NM_078843.4  CG3479-RB, transcript variant B (osp), mRNA 
0   NM_168624.1  CG7945-RA, transcript variant A (CG7945), mRNA 
0   NM_206372.1  CG7945-RC, transcript variant C (CG7945), mRNA 
0   12  NM_143745.2  CG18389-RA (Eip93F), mRNA 
0   NM_169137.1  CG10295-RC, transcript variant C (Pak), mRNA 
0   NM_079942.3  CG10295-RB, transcript variant B (Pak), mRNA 
0   NM_001014605.1  CG1119-RB, transcript variant B (Gnf1), mRNA 
0   NM_079505.2  CG1119-RA, transcript variant A (Gnf1), mRNA 
0   NM_136041.1  CG10231-RA (Pde11), mRNA 
0   12  NM_058003.3  CG5216-RA (Sir2), mRNA 
0   19  NM_144448.2  CG1915-RC, transcript variant C (sls), mRNA 
0   NM_165025.1  CG9828-RB, transcript variant B (DnaJ-H), mRNA 
0   17  NM_140064.2  CG32043-RA, transcript variant A (CG32043), mRNA 
0   17  NM_168346.1  CG32043-RB, transcript variant B (CG32043), mRNA 
0   NM_135279.1  CG15819-RA (CG15819), mRNA 
0   NM_206125.1  CG8295-RD, transcript variant D (Mlf), mRNA 
0   NM_166122.2  CG8295-RC, transcript variant C (Mlf), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.