National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 6895R-2 
 Symbol GNBP1  Full Name Gram-negative bacteria binding protein 1 
 CG No CG6895  Old CG No CG6895 
 Synonyms GNBP1, DGNBP-1, GNBP, DGNBP1, CG6895 
 Accession No (Link to NCBI) NM_079418.2 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
Pili-Floury S, Leulier F, Takahashi K, Saigo K, Samain E, Ueda R, Lemaitre B.
In vivo RNA interference analysis reveals an unexpected role for GNBP1 in the defense against Gram-positive bacterial infection in Drosophila adults.
J. Biol. Chem. (2004) 279(13) 12848-53 [ PubMed ID = 14722090 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgAAGAGGGCGTAAAAGTGGTGG 
 Primer Seq. 3'
aatctagaggtaccGTACAAGACGAACTCTGCATC 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 AAGAGGGCGT AAAAGTGGTG GCCTTTAATG TAAATCGCAA TCGGAATTTC ACATCCTTCA 
0061 TCAACGAGGG GACAGTACAA TGTGAGATTG ACTGAACCCC AGAACGGCAG GTGGACGACC 
0121 AACTTCAGTT CGGTTCCCTT GAGATCCCAA GATGTTCTAT ACCTTTGGAC AAGTGTGCAG 
0181 CACCAAAAGG CTGTGTATCA AGATCTGGCG CAGNCCCTGC CAGTCTGCAA TCTTGGCGGA 
0241 GAGTATCGGC CCAGGGGATG TTCCCCCGGT GATGATGACT TTACGGATGA CAACCAGCTA 
0301 AGTACTGAGG ACAGTGCTTT GGAACCCACC GCTCCCTCCG TCTGTGAACC TTCTGAAAGC 
0361 CAGGTTTCGC CGCAAATCGG TGTTTCCATA TGTAAGGGAC AACTTCTGTT TGAGGAGACT 
0421 TTTGATCAGC TGAATGAATC TCTGTGGATA CATGATGTTC GCCTGCCCCT CGACTCCAAG 
0481 GATGCAGAGT TCGTCTTGAG TAC 
 in silico PCR Fragment
0001 AAGAGGGCGT AAAAGTGGTG GCCTTTAATG TAAATCGCAA TCGGAATTTC ACATCCTTCA 
0061 TAAACGA-GG GACAGTACAA TGTGAGATTG ACTGAACCCC AGAACGGCAG GTGGACGACC 
0121 AACTTCAGTT CGGTTCCCTT GAGATCCCAA GATGTTCTAT ACCTTTGGAC AAGTGTGCAG 
0181 CACCAAAAGG CTGTGTATCA AGATCTGGCG CAGCCCCTGC CAGTCTGCAA TCTCGGCGGA 
0241 GAGTATCGGC CCAGGGGATG TTCGCCCGGT GATGATGACT TTACGGATGA CAACCAGCTA 
0301 AGTACTGAGG ACAGTGCTTT GGAACCCACC GCTCCCTCCG TCTGTGAACC TTCTGAAAGC 
0361 CAGGTTTCGC CGCAAATCGG TGTTTCCATA TGTAAGGGAC AACTTTTGTT TGAGGAGACT 
0421 TTTGATCAGC TGAATGAATC TCTGTGGATA CATGATGTTC GCCTGCCCCT CGACTCCAAG 
0481 GATGCAGAGT TCGTCTT--G TAC 
 Assemble Data

6895R-2.IR_full       1   AAGAGGGCGTAAAAGTGGTGGCCTTTAATGTAAATCGCAATCGGAATTTCACATCCTTCA 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6895R-2.in silico     1   AAGAGGGCGTAAAAGTGGTGGCCTTTAATGTAAATCGCAATCGGAATTTCACATCCTTCA 60


6895R-2.IR_full       61  TCAACGAGGGGACAGTACAATGTGAGATTGACTGAACCCCAGAACGGCAGGTGGACGACC 120
                          | ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||
6895R-2.in silico     61  TAAACGA-GGGACAGTACAATGTGAGATTGACTGAACCCCAGAACGGCAGGTGGACGACC 120


6895R-2.IR_full       121 AACTTCAGTTCGGTTCCCTTGAGATCCCAAGATGTTCTATACCTTTGGACAAGTGTGCAG 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6895R-2.in silico     121 AACTTCAGTTCGGTTCCCTTGAGATCCCAAGATGTTCTATACCTTTGGACAAGTGTGCAG 180


6895R-2.IR_full       181 CACCAAAAGGCTGTGTATCAAGATCTGGCGCAGNCCCTGCCAGTCTGCAATCTTGGCGGA 240
                          ||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||||
6895R-2.in silico     181 CACCAAAAGGCTGTGTATCAAGATCTGGCGCAGCCCCTGCCAGTCTGCAATCTCGGCGGA 240


6895R-2.IR_full       241 GAGTATCGGCCCAGGGGATGTTCCCCCGGTGATGATGACTTTACGGATGACAACCAGCTA 300
                          ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||
6895R-2.in silico     241 GAGTATCGGCCCAGGGGATGTTCGCCCGGTGATGATGACTTTACGGATGACAACCAGCTA 300


6895R-2.IR_full       301 AGTACTGAGGACAGTGCTTTGGAACCCACCGCTCCCTCCGTCTGTGAACCTTCTGAAAGC 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6895R-2.in silico     301 AGTACTGAGGACAGTGCTTTGGAACCCACCGCTCCCTCCGTCTGTGAACCTTCTGAAAGC 360


6895R-2.IR_full       361 CAGGTTTCGCCGCAAATCGGTGTTTCCATATGTAAGGGACAACTTCTGTTTGAGGAGACT 420
                          ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||
6895R-2.in silico     361 CAGGTTTCGCCGCAAATCGGTGTTTCCATATGTAAGGGACAACTTTTGTTTGAGGAGACT 420


6895R-2.IR_full       421 TTTGATCAGCTGAATGAATCTCTGTGGATACATGATGTTCGCCTGCCCCTCGACTCCAAG 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6895R-2.in silico     421 TTTGATCAGCTGAATGAATCTCTGTGGATACATGATGTTCGCCTGCCCCTCGACTCCAAG 480


6895R-2.IR_full       481 GATGCAGAGTTCGTCTTGAGTAC 503
                          |||||||||||||||||  ||||
6895R-2.in silico     481 GATGCAGAGTTCGTCTT--GTAC 503

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_079418.2  CG6895-RA (GNBP1), mRNA 
0   NM_141181.2  CG1107-RB, transcript variant B (auxillin), mRNA 
0   NM_164317.2  CG1107-RA, transcript variant A (auxillin), mRNA 
0   NM_142248.2  CG31183-RA (CG31183), mRNA 
0   NM_001007096.1  CG8742-RB, transcript variant B (Gyc76C), mRNA 
0   NM_001007095.1  CG8742-RC, transcript variant C (Gyc76C), mRNA 
0   NM_079441.3  CG8742-RA, transcript variant A (Gyc76C), mRNA 
0   NM_130481.2  CG13375-RA (CG13375), mRNA 
0   NM_142597.2  CG12254-RA (MED25), mRNA 
0   NM_138200.2  CG12030-RA (CG12030), mRNA 
0   NM_142433.1  CG14314-RA (CG14314), mRNA 
0   NM_079427.2  CG6850-RA (Ugt), mRNA 
0   NM_144448.2  CG1915-RC, transcript variant C (sls), mRNA 
0   NM_165863.2  CG16747-RA, transcript variant A (Oda), mRNA 
0   NM_165864.2  CG16747-RC, transcript variant C (Oda), mRNA 
0   NM_165865.2  CG16747-RB, transcript variant B (Oda), mRNA 
0   NM_140773.1  CG5137-RA (Cyp312a1), mRNA 
0   NM_078559.2  CG18085-RA (sev), mRNA 
0   NM_141066.1  CG7540-RA, transcript variant A (M6), mRNA 
0   NM_132268.1  CG12772-RA (CG12772), mRNA 
0   NM_080217.2  CG9334-RA (Spn3), mRNA 
0   NM_176528.1  CG33092-RA, transcript variant A (CG33092), mRNA 
0   NM_176531.1  CG33092-RF, transcript variant F (CG33092), mRNA 
0   NM_168911.1  CG7540-RB, transcript variant B (M6), mRNA 
0   NM_176533.1  CG33092-RE, transcript variant E (CG33092), mRNA 
0   NM_176534.1  CG33092-RG, transcript variant G (CG33092), mRNA 
0   NM_164469.1  CG17239-RA (CG17239), mRNA 
0   NM_176529.1  CG33092-RB, transcript variant B (CG33092), mRNA 
0   NM_176532.1  CG33092-RD, transcript variant D (CG33092), mRNA 
0   NM_176530.1  CG33092-RC, transcript variant C (CG33092), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.