National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 6895R-1 
 Symbol GNBP1  Full Name Gram-negative bacteria binding protein 1 
 CG No CG6895  Old CG No CG6895 
 Synonyms GNBP1, DGNBP-1, GNBP, DGNBP1, CG6895 
 Accession No (Link to NCBI) NM_079418.2 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
[Please submit your publication]
Pili-Floury S, Leulier F, Takahashi K, Saigo K, Samain E, Ueda R, Lemaitre B.
In vivo RNA interference analysis reveals an unexpected role for GNBP1 in the defense against Gram-positive bacterial infection in Drosophila adults.
J. Biol. Chem. (2004) 279(13) 12848-53 [ PubMed ID = 14722090 ] [ RRC reference ]  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     1   AAGAGGGCGTAAAAGTGGTGGCCTTTAATGTAAATCGCAATCGGAATTTCACATCCTTCA 60

                          | ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| silico     61  TAAACGA-GGGACAGTACAATGTGAGATTGACTGAACCCCAGAACGGCAGGTGGACGACC 120

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     121 AACTTCAGTTCGGTTCCCTTGAGATCCCAAGATGTTCTATACCTTTGGACAAGTGTGCAG 180

                          ||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||||| silico     181 CACCAAAAGGCTGTGTATCAAGATCTGGCGCAGCCCCTGCCAGTCTGCAATCTCGGCGGA 240

                          ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| silico     241 GAGTATCGGCCCAGGGGATGTTCGCCCGGTGATGATGACTTTACGGATGACAACCAGCTA 300

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     301 AGTACTGAGGACAGTGCTTTGGAACCCACCGCTCCCTCCGTCTGTGAACCTTCTGAAAGC 360

                          ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| silico     361 CAGGTTTCGCCGCAAATCGGTGTTTCCATATGTAAGGGACAACTTTTGTTTGAGGAGACT 420

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     421 TTTGATCAGCTGAATGAATCTCTGTGGATACATGATGTTCGCCTGCCCCTCGACTCCAAG 480

6895R-1.IR_full       481 GATGCAGAGTTCGTCTTGAGTAC 503
                          |||||||||||||||||  |||| silico     481 GATGCAGAGTTCGTCTT--GTAC 503

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_079418.2  CG6895-RA (GNBP1), mRNA 
0   NM_141181.2  CG1107-RB, transcript variant B (auxillin), mRNA 
0   NM_164317.2  CG1107-RA, transcript variant A (auxillin), mRNA 
0   NM_142248.2  CG31183-RA (CG31183), mRNA 
0   NM_001007096.1  CG8742-RB, transcript variant B (Gyc76C), mRNA 
0   NM_001007095.1  CG8742-RC, transcript variant C (Gyc76C), mRNA 
0   NM_079441.3  CG8742-RA, transcript variant A (Gyc76C), mRNA 
0   NM_130481.2  CG13375-RA (CG13375), mRNA 
0   NM_142597.2  CG12254-RA (MED25), mRNA 
0   NM_138200.2  CG12030-RA (CG12030), mRNA 
0   NM_142433.1  CG14314-RA (CG14314), mRNA 
0   NM_079427.2  CG6850-RA (Ugt), mRNA 
0   NM_144448.2  CG1915-RC, transcript variant C (sls), mRNA 
0   NM_165863.2  CG16747-RA, transcript variant A (Oda), mRNA 
0   NM_165864.2  CG16747-RC, transcript variant C (Oda), mRNA 
0   NM_165865.2  CG16747-RB, transcript variant B (Oda), mRNA 
0   NM_140773.1  CG5137-RA (Cyp312a1), mRNA 
0   NM_078559.2  CG18085-RA (sev), mRNA 
0   NM_141066.1  CG7540-RA, transcript variant A (M6), mRNA 
0   NM_132268.1  CG12772-RA (CG12772), mRNA 
0   NM_080217.2  CG9334-RA (Spn3), mRNA 
0   NM_176528.1  CG33092-RA, transcript variant A (CG33092), mRNA 
0   NM_176531.1  CG33092-RF, transcript variant F (CG33092), mRNA 
0   NM_168911.1  CG7540-RB, transcript variant B (M6), mRNA 
0   NM_176533.1  CG33092-RE, transcript variant E (CG33092), mRNA 
0   NM_176534.1  CG33092-RG, transcript variant G (CG33092), mRNA 
0   NM_164469.1  CG17239-RA (CG17239), mRNA 
0   NM_176529.1  CG33092-RB, transcript variant B (CG33092), mRNA 
0   NM_176532.1  CG33092-RD, transcript variant D (CG33092), mRNA 
0   NM_176530.1  CG33092-RC, transcript variant C (CG33092), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.